Busch Lab

ZMP

LOC557854

Ensembl ID:
ENSDARG00000006447
Human Orthologue:
SLC19A3
Human Description:
solute carrier family 19, member 3 [Source:HGNC Symbol;Acc:16266]
Mouse Orthologue:
Slc19a3
Mouse Description:
solute carrier family 19 (sodium/hydrogen exchanger), member 3 Gene [Source:MGI Symbol;Acc:MGI:19313

Alleles

There are 8 alleles of this gene:

Allele Name Consequence Status Availability
sa8826 Nonsense Available for shipment Available now
sa9460 Nonsense Available for shipment Available now
sa9738 Nonsense Available for shipment Available now
sa28507 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa11401 Nonsense Available for shipment Available now
sa981 Nonsense Available for shipment Available now
sa9099 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa6389 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa8826
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059204 Nonsense 30 501 1 6
ENSDART00000059204 Nonsense 30 501 1 6
Genomic Location (Zv9):
Chromosome 15 (position 34435977)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 35281753
GRCz11 15 35139722
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TCCCACTTCTCTCTTGTTYATCTATGGATTCTTCAGCACAGTCAAGCCTT[T/A]AGAGCCGTTTCTYTACCCATTCCTCACTGGACCAGACAAGAACCTGMCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9460
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059204 Nonsense 30 501 1 6
ENSDART00000059204 Nonsense 30 501 1 6
Genomic Location (Zv9):
Chromosome 15 (position 34435977)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 35281753
GRCz11 15 35139722
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TCCCACTTCTCTCTTGTTYATCTATGGATTCTTCAGCACAGTCAAGCCTT[T/A]AGAGCCGTTTCTYTACCCATTCCTCACTGGACCAGACAAGAACCTGMCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9738
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059204 Nonsense 218 501 2 6
Genomic Location (Zv9):
Chromosome 15 (position 34440557)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 35286333
GRCz11 15 35144302
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GCAGAGCGAAGAGGATGATRMTGAAGGACATTCTGGGAATGTCAAACCTT[T/A]GGAGCCTGAGGAAGGATTTGGGACAATGGTTGATCTTAGTAATGATGTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa28507
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059204 Essential Splice Site 265 501 2 6
Genomic Location (Zv9):
Chromosome 15 (position 34440701)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 35286477
GRCz11 15 35144446
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TAATGGCTGTGATAGTAGTAGTGCAAAAAGTTCCAAGTCGAGTAGGAAAG[G/A]TGAGTTGAATCTGCAAAAAAAGAGTGCATTAATGGATCGCCTGAAAATAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11401
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059204 Nonsense 291 501 3 6
Genomic Location (Zv9):
Chromosome 15 (position 34443431)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 35289207
GRCz11 15 35147176
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GTTRTGGAGGGATTTCCTGCAGTGTTTCTCCTCCCGAACRCTGCTTCTCT[G/A]GTCAGCCTGGTGGGCTTTGGCCACTTGTGGCTACAACCAGACGGTCAACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa981
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059204 Nonsense 325 501 3 6
Genomic Location (Zv9):
Chromosome 15 (position 34443534)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 35289310
GRCz11 15 35147279
KASP Assay ID:
554-0886.1 (used for ordering genotyping assays)
KASP Sequence:
GTCCAGTCRCTCTGGGAGCATGTAGAGCCTTCTAGTAACTTCACAGTCTA[C/A]AATGGAGGAGCGGAGGCACTCTCAAACCTGTTCGGTGAGAAAAAAGAAAA
Associated Phenotype:
Normal
Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa9099
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059204 Essential Splice Site 337 501 3 6
Genomic Location (Zv9):
Chromosome 15 (position 34443570)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 35289346
GRCz11 15 35147315
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AACTTCACWGTCTAMAATGGAGGAGCGGAGGCACTCTCAAACCTGTTCGG[T/G]GAGAAAAAAGAAAAGACCTTAGACATGCAAAGATGTTGCCCGTTGCATAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6389
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059204 Nonsense 393 501 4 6
Genomic Location (Zv9):
Chromosome 15 (position 34445720)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 35291496
GRCz11 15 35149465
KASP Assay ID:
554-4510.1 (used for ordering genotyping assays)
KASP Sequence:
GGGAACATCTGGGTCTGTTACGGCGGCTACATCCTCTTTAAAAGCCTCTA[T/A]ATGCTGCTCATCACCATTGCCATGTAAGTGAAATGACTTACTATCTATGT
Associated Phenotype:
Not determined