Busch Lab

ZMP

atrnl1

Ensembl ID:
ENSDARG00000006420
ZFIN ID:
ZDB-GENE-030131-8092
Human Orthologue:
ATRNL1
Human Description:
attractin-like 1 [Source:HGNC Symbol;Acc:29063]
Mouse Orthologue:
Atrnl1
Mouse Description:
attractin like 1 Gene [Source:MGI Symbol;Acc:MGI:2147749]

Alleles

There are 7 alleles of this gene:

Allele Name Consequence Status Availability
sa6257 Nonsense Mutation detected in F1 DNA Not yet available
sa22125 Nonsense Available for shipment Available now
sa18278 Nonsense Available for shipment Available now
sa8730 Nonsense Mutation detected in F1 DNA Not yet available
sa7363 Missense Mutation detected in F1 DNA Not yet available
sa31883 Nonsense Available for shipment Available now
sa35315 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa6257
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042514 Nonsense 202 1364 5 29
Genomic Location (Zv9):
Chromosome 12 (position 31549636)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 29858979
GRCz11 12 29973881
KASP Assay ID:
554-4925.1 (used for ordering genotyping assays)
KASP Sequence:
CTCAACAGAATCAACTCATGTCCAAATAACTGCTCTGGCCACGGGAAGTG[T/A]TCCTCGGGGAACTCGAYAGCGAGTCGTGTGTATTGTGACTGTGAGAACTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22125
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042514 Nonsense 207 1364 5 29
Genomic Location (Zv9):
Chromosome 12 (position 31549622)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 29858965
GRCz11 12 29973867
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTCATGTCCAAATAACTGCTCTGGCCACGGGAAGTGTTCCTCGGGGAACT[C/A]GATAGCGAGTCGTGTGTATTGTGACTGTGAGAACTTCTGGAAGGGTGAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18278
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042514 Nonsense 468 1364 9 29
Genomic Location (Zv9):
Chromosome 12 (position 31541713)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 29851056
GRCz11 12 29965958
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGCAGTGTGTATGATAGAGGCAGCAAAAGTGTGTACGTCCAYGRGGGTTA[C/A]AGAWCTCTTCCAGCAAACAAATATGGCCTGGTGGATGAWCTTTACCGCTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8730
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042514 Nonsense 961 1364 18 29
Genomic Location (Zv9):
Chromosome 12 (position 31522848)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 29832173
GRCz11 12 29947075
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGTGGAGACCCCAGTAACACCGGCCGAGGGCAGTGCATGGAGGGTTCGTA[T/G]CGCGGACCCATGAAGAGCCCCTCCAGACACAGTCAAGACATGGTGCTGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7363
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > G
Consequence:
Missense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042514 Missense 1198 1364 24 29
Genomic Location (Zv9):
Chromosome 12 (position 31494817)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 29806181
GRCz11 12 29921083
KASP Assay ID:
554-4317.1 (used for ordering genotyping assays)
KASP Sequence:
ACAGYAACCCAAACATCACMTTCTATGTGTATGTCAGCAACTTCTCATGG[C/G]CAATCAAAATACAGGTAAGGACTCTTTTCCTCTGGTTTGTCAGCTATTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31883
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042514 Nonsense 1312 1364 28 29
Genomic Location (Zv9):
Chromosome 12 (position 31424819)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 29737924
GRCz11 12 29852826
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCTGTTCAGGGGGTAAAGCTGCAGTGCTTACGGTGCTAATGTGCCTCCCA[C/T]GAGTGGCATCTGGTGTCCCTCCACCCGGCCAGTCAGGTCAGTAATTTACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35315
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042514 Nonsense 1363 1364 29 29
Genomic Location (Zv9):
Chromosome 12 (position 31416851)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 29729956
GRCz11 12 29844858
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAAGGATTGAAGAACCGCAAAGCTCTGCCTCCTGCTCACCAGGGCACCTG[C/A]GTTTGAATCGTCTGTGGCCTCGGTGGGCTGTCCTTTTTTCCAGAGCGACC
Associated Phenotype:
Not determined