Busch Lab

ZMP

rbm25

Ensembl ID:
ENSDARG00000006395
ZFIN ID:
ZDB-GENE-030131-5547
Description:
RNA binding motif protein 25 [Source:RefSeq peptide;Acc:NP_956084]
Human Orthologues:
AC002365.1, AC003980.1, AC006062.1, AC006999.1, AC007379.1, AC008162.1, AC008573.1, AC008794.1, AC009021.1, AC010133.1, AC011503.2, AC012596.1, AC016595.1, AC022409.1, AC022486.1, AC023481.1, AC067941.1, AC092485.1, AC097714.1, AC116351.3, AL121899.1, AL138690.1, AL159986.1, AL357512.1, AL591242.1, RBM25
Human Description:
RNA binding motif protein 25 [Source:HGNC Symbol;Acc:23244]
Mouse Orthologues:
Gm10563, Rbm25
Mouse Descriptions:
RNA binding motif protein 25 Gene [Source:MGI Symbol;Acc:MGI:1914289]
predicted gene 10563 Gene [Source:MGI Symbol;Acc:MGI:3642630]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa3072 Nonsense F2 line generated Not yet available
sa23821 Nonsense Available for shipment Available now
sa43545 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa3072
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027836 Nonsense 172 830 6 18
ENSDART00000113929 Nonsense 172 833 5 20
ENSDART00000114407 Nonsense 172 731 6 16

The following transcripts of ENSDARG00000006395 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 51508734)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 51360803
GRCz11 20 51174023
KASP Assay ID:
554-2928.1 (used for ordering genotyping assays)
KASP Sequence:
AAGCTTCTGGTCAAAGTGGATGCCAAAACCAAAGCACAACTGGACGAGTG[G/A]AAAGCAAAGAAGAAGAGCACCAGTGCAAACGGAGTCAGTATTATACCAGT
Long Flanking Sequence:
CAATGTTTATGTGCGATTTGGACCAGCATAGGCTCATAACACTAAAGTGCTCTTTTAATAACGAGCAAAAACAGCAGCTTTTAGTTGGTCAATGTTGCTGTTTTCTCAAAATAGCAGCCCGCCAACAATACGCCTTAACACACATCCTTTTCAGGCCAACACACCCATGGGTGTACAAACGGATACAAATGCAATTACTGTTACACCTAAACATTAAAATGAAACATGCACCTAGAAGGAAATGGCAAAAAAAAAACTGGTACTGCGTTGATCATGATCTCTTGAGTTCAATATGTTGCACTGCCTGGAAATGGTTTTCACGACAGGCTCGATGCTCATAGCCTTTGTTTTGTTCTTTGGCTTTCAGCGTTTGGTTTCTGCGAGTACAAAGAGCCTGAATCAACTCTACGAGCTCTCCGGCTGCTACATGAGCTTCAGGTTGGAGAAAAGAAGCTTCTGGTCAAAGTGGATGCCAAAACCAAAGCACAACTGGACGAGTG[G/A]AAAGCAAAGAAGAAGAGCACCAGTGCAAACGGAGTCAGTATTATACCAGTTATCAGATATCAGGTTGTTAAGAAAGATCTGTTTAAGAAGATTAACTGATGATAAACCTCTTTTAATTTGCATGACATGTTCTTTGTGGCTGGTAGGCCTCAGCGAAGTCATTTCATATCCCTATAATGATAAATATAATGATATAATAGCTTTTTGTAAACAGGGAAACCAGCAACAATCAAGAATGCATGATTATATGGTGTCATGGCTTTGCAATCAAAAAATGGGATTATAATGGAAGTGATTGGGGGAAAAACAGCCACAAACATAAAGAAAGGGTAGCAAATTTGCCCAAAGTGTATCGTTGAATATTTGAGAAGTATTGTCCCAAAATGTGTGACTAAATAGTATTTGTCTGCAACAATCATCTTGTTAGATTTTGCTGTATTTGGCTTAACCGTTCTTGGGTGGCTCGCCAATGTATTAGATTACTCTAATACATAAAACAA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4133
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027836 Essential Splice Site 273 830 8 18
ENSDART00000113929 Essential Splice Site 273 833 7 20
ENSDART00000114407 Essential Splice Site 273 731 8 16

The following transcripts of ENSDARG00000006395 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 51502824)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 51354893
GRCz11 20 51168113
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AAGAGAYTTGATTTCCAGGGAGATCAACAAGTTCCGCGACACACACAAGG[T/C]AAAATACATGCTAATTTACTCCATAAYACAGGTAGTGCACAAAAAAAGCA
Long Flanking Sequence:
AGTTAGACCCAAAATTTATGATCATCTGTGTTTCTGGCAGAATGGTAAGGCAGATGATGCTGGCGAAGAGGAAGAGGAGGTTCTGGATGAAGAAACTAAGAAGCGGGACCAAATCGTCAAAGGTGCCATTGACGGTCTGATCCGGGAGTATTCAAGTGAGCTCAATGCTCAGTCACAGGACGATGAGTCGAGTCGCAGGAAAAAGAAGAGAGAAAAGAAGGACGAGGTTGGCTTTAGTTGACCTGTTTTACTACTATTTTGCCTAAGCGAAGCTAAAAGAGCTCTCAGCAGACTTAGAGATTGGCTGAATATAATAAAACTGCTTAAATTCTATGGGGGCTGTAAAATGAGCCTGTTTTCCAAAAACATAGGATATAAATTGGCTAACCGTGTTTTCCCACCATTGCCTGTGTAGGATGACATCAATGCCATGGAAATGGAGGATGACAAAAGAGATTTGATTTCCAGGGAGATCAACAAGTTCCGCGACACACACAAGG[T/C]AAAATACATGCTAATTTACTCCATAACACAGGTAGTGCACAAAAAAAGCATCTCACACCTAGTTTAATTAGTCGAATATCCAGCATGAGTAGATCTGTAGTCTGTACATTTCCATTCAGCACAGCAAATTCAGTTTATTACCTTTTAAGATTGATTTTAATTGATAGAAAGTACTCTAGGACTCATTTGGACGCATTTATTATTTACATTTATTGTAAATTTGTAAACAAACAATAACTGTAGCGTGGCCGACATGTTAAGGGTGGGAAATGTAGTCACACATACAATGCATGGACGTTCTGTGCACTTCCCTAAAAGCTAATCTATTCATTAAACCCCACCATTATGATAGAGATCATATGGTGACTAAACCAAGATGAATCTCTCAGCTTTGGGAAAAAGTTGCAAGGATAGGATGTAAGTATGAGCTTTCCATTTTTCTCTACTTGTATTGGGCGCCCCCTTCTGGACGGCTCGCACAGGGGCAACTGCACCGGCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23821
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027836 Nonsense 359 830 9 18
ENSDART00000113929 Nonsense 315 833 9 20
ENSDART00000114407 Nonsense 359 731 9 16

The following transcripts of ENSDARG00000006395 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 51491705)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 51343774
GRCz11 20 51156994
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATAGAGATTGGGAGAGAGACCGAAGCAGAGACCGAAGCGAGGGCCGCAGT[C/T]GATCCAGGTATGCAACACCTCACCTCTTCAGGTGGCCTATTATGACGAAT
Long Flanking Sequence:
AGTCTTTGTCCAGCACTAATCGTGATGTGTTATATGAGTCAACTATTTAAAATACATAATTTGATATTAAATTAGCAAACATTTTCGTAAGAGTTCTCGTGCTTTTGCTGCCTCTATACGAGTGACTTTATTTAAATGGCAGGGACTGTAAACCACTTCCTCATAGAGTGATGTTGTGTGTTGTGCTGGTCTTAAATGTGAGCAACAGCTAATCCGGAAACTTCCTCCCCATTTTCCCCCCACAGAAACTGGAAGAGGAGAAGGGGAAGCGAGAGAAGGAGCGGCAGGAGCTGGAGCGGGAACGAAAGGAAAGAGATAAGGAGCGGGAACGGGAGCGAGAACGGAGAGACCGTGAACGGGAGAAAGAAAGAGAGCGCGAACGGGAGAGAGAACGAGAGCGCGAGAGGGAGAGAGATCGAGACCGCGAGCGCACGAAGGAGAGAGACAGGGATAGAGATTGGGAGAGAGACCGAAGCAGAGACCGAAGCGAGGGCCGCAGT[C/T]GATCCAGGTATGCAACACCTCACCTCTTCAGGTGGCCTATTATGACGAATGTATTTATTGGACTGCGGTATACGCACAGTAGAGATGCGCGGATCAGCTGACACTTAAATAATTCTTTGTTTTGGGCATGATGATAGGTCACCGTGGATTTTAACAGCAGATTCAGTGGGCTGATCTGCACCTCTATTAGTAAAATAATAGCCTACATTAATTGTAAACGTTTGTAAATGAATATTTATTTATTAAAAACAAAAGTTTGTCTTTGGACAACATTTTCTTTATTTTCAAATACAGAAAGTAAACATAAGACATTTTAGCTTTTACAGATACTGGAACAAGATAACAAAAAGGGTGCACTTCAGCCTAAACGGCAGCTATGTTGTGTTTACTTGGCCTTTTTTTTTTTTGCACTGTGCAAAAACAGAATAGCATCTACGTGTGCCCCCCACGTGTATATAATTCTATCTAGCAGGTAGGAGTGGGTGATTTTTCAGATTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43545
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027836 Nonsense 633 830 14 18
ENSDART00000113929 Nonsense 636 833 16 20
ENSDART00000114407 Nonsense 633 731 14 16

The following transcripts of ENSDARG00000006395 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 51480567)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 51332636
GRCz11 20 51145856
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CACTCCCAGAGAAGAGTCACCCTGCGGCATCATCATCCCACATGAGAACT[C/A]GCCACAGGAGATGCTGCTTCCGGAAGAGAACAGGCCCAAGATCGGCCTCA
Long Flanking Sequence:
TAAGACTTTCTCCAGAAGAAAAGATATTATCAAATATTATATGAAACATCACCCCAGAGTGGATGTAAACATCCCCAACAGCACACAAGGCTTAACTGAGCTATTTTGTTCTGCTTGTGTTCATCAGATGGAGGAAGAGGCTGAGCGTTTACGGCAGCCACCTGTAAAGCCTGAGCCGGAGGAGGAGCGAGAGCACAAACCCTCACGAGAAGAGCGAGACCGCGAGCGAGGCCGAGACAGAGACCGACGCAAGGCTCCTGTAGAAACACACACTCACGTTCATGCTCATGTTCACACTCACGTTCATGCTAACATCCCGTCTGACGATGATGTGGAGGAAGGAGAGGAGATCGAGGACGAGGAGGAGCCCAAACCTTGCCTCAAACCCACTATGAGGCCCATCACAGCGGCACCCTCGGTGTCTTCAGCCAGCGGAAACGCCACGCCGAACACTCCCAGAGAAGAGTCACCCTGCGGCATCATCATCCCACATGAGAACT[C/A]GCCACAGGAGATGCTGCTTCCGGAAGAGAACAGGCCCAAGATCGGCCTCAGCCTCAAACTGGGTGAGTCTGACTGCACCTCAACTTATCTTTATCTCTATAGCGCTTTTACAATGTAGATCGTGTCAAAGCAGATCTTCTAGTAAATTAAAACTGCTTCAGTCTAGTTTTCAAAGTTGAAGTTCAGTTCAGTGTATTAATGTAAATGTCACTGCTGTAAGTCCAAACACTGAAGAGCAAATCCACCAATGCACAGCTCCACAAGTCCCAAACCAAGCAAGCCAGTGGTGAGGAGAGTTATAAGTCAACCCCCCTCCCCCCAATCTCAGTAGGGTGTTTTCACATCTCTAGTTTAAAGAGTCACGAAACACCAAAACACATGTGTTTAAGCTGTTGACAGTCGTATATGTTTCCCACACTGCTAAAAACACTAATAGAACACATATATCTTACTAAAAAGTGAAAATTGGTTGTTTTTGCGTTATTTCGTGCAAATTCGTA
Associated Phenotype:
Not determined