Busch Lab

ZMP

smad2

Ensembl ID:
ENSDARG00000006389
ZFIN ID:
ZDB-GENE-990603-7
Description:
Mothers against decapentaplegic homolog 2 [Source:UniProtKB/Swiss-Prot;Acc:Q9I9P9]
Human Orthologue:
SMAD2
Human Description:
SMAD family member 2 [Source:HGNC Symbol;Acc:6768]
Mouse Orthologue:
Smad2
Mouse Description:
MAD homolog 2 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:108051]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa21685 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa21685
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044756 Essential Splice Site None 468 None 11
ENSDART00000121892 Essential Splice Site None 469 None 11
ENSDART00000128579 None None 483 None 11
ENSDART00000137430 None None 74 None 3
ENSDART00000143608 None None 160 None 5
ENSDART00000147653 Essential Splice Site None 469 None 12
Genomic Location (Zv9):
Chromosome 10 (position 14958066)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 14971373
GRCz11 10 14929492
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CGGATTTTACGCCACCGCTTTATTACGGAGAACGCTTTTCGTAGGAAGGG[T/C]GAGTTGGATGGGTAAGCGAGAAGACAACGGCTCGCAAACCCCCTTTGAAA
Associated Phenotype:
Not determined