Busch Lab

ZMP

si:ch211-194d6.1

Ensembl ID:
ENSDARG00000006383
ZFIN ID:
ZDB-GENE-041210-220
Description:
Syntaxin-binding protein 5-like [Source:UniProtKB/Swiss-Prot;Acc:Q5SQE2]
Human Orthologue:
STXBP5L
Human Description:
syntaxin binding protein 5-like [Source:HGNC Symbol;Acc:30757]
Mouse Orthologue:
Stxbp5l
Mouse Description:
syntaxin binding protein 5-like Gene [Source:MGI Symbol;Acc:MGI:2443815]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa31716 Nonsense Available for shipment Available now
sa34660 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa34659 Essential Splice Site Available for shipment Available now
sa2514 Nonsense F2 line generated Not yet available

Mutation Details

Allele Name:
sa31716
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017292 Nonsense 193 1159 5 26
ENSDART00000138602 None None 214 None 3
Genomic Location (Zv9):
Chromosome 9 (position 28554257)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 27709953
GRCz11 9 27520699
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CGTGGGAATACACACATAGTGAACATTGAATCCTTCATTTTGTCTGGATA[T/A]GTCATCATGTGGAACAAGGCCATTGAACTGTGAGTACAAGCTGTTTTGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34660
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017292 Essential Splice Site 482 1159 14 26
ENSDART00000138602 None None 214 None 3
Genomic Location (Zv9):
Chromosome 9 (position 28507016)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 27662712
GRCz11 9 27473458
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCCCACAGACATGCAGACGGATCGATAAAGTTTTGGGATGCCACAGCGAG[T/C]AAGTGTCTTAGCTTTGAAGAGCTTGTGCTTCTCTTTCAGCCTCATGCTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34659
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017292 Essential Splice Site 1072 1159 24 26
ENSDART00000138602 None None 214 None 3
Genomic Location (Zv9):
Chromosome 9 (position 28454960)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 27610656
GRCz11 9 27421402
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TAAGGGCTTTTTTGGTGGCAATGCCCAAACCTTCGACAGAGAGGAGTTAT[G/T]TGAGTGTGCATATATTTATCAAGCCCCCCTCACCCCCTCTTTCTCTCGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2514
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017292 Nonsense 1156 1159 26 26
ENSDART00000138602 None None 214 None 3
Genomic Location (Zv9):
Chromosome 9 (position 28449752)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 27605448
GRCz11 9 27416194
KASP Assay ID:
554-3208.1 (used for ordering genotyping assays)
KASP Sequence:
GCTTTTCCTTTTTTTCCACAGCTAATGCTTAAATGCAAAGRCAAGAAGTG[G/A]TATCAGTTTTAGAGGGTCCTCTTGGAGGCGTGTTTCACTGTCRTGCCACA
Associated Phenotype:
Not determined