Busch Lab

ZMP

atp6v1h

Ensembl ID:
ENSDARG00000006370
ZFIN ID:
ZDB-GENE-021219-2
Description:
V-type proton ATPase subunit H [Source:RefSeq peptide;Acc:NP_775377]
Human Orthologue:
ATP6V1H
Human Description:
ATPase, H+ transporting, lysosomal 50/57kDa, V1 subunit H [Source:HGNC Symbol;Acc:18303]
Mouse Orthologue:
Atp6v1h
Mouse Description:
ATPase, H+ transporting, lysosomal V1 subunit H Gene [Source:MGI Symbol;Acc:MGI:1914864]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa25830 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa12036 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa25830
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019029 None None 463 None 13
ENSDART00000099043 Essential Splice Site 172 481 6 13
ENSDART00000145681 Essential Splice Site 172 481 7 14

The following transcripts of ENSDARG00000006370 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 30522124)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 30823759
GRCz11 2 30807292
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGCCCAAAATCACCGTTTTTTTCTTTCTATCTTTTTTTTTGTTGTTGTTA[G/A]AAACTACATGGTACAGGTGCTGAACCTGGAACAGGGACCATCTCCCCCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12036
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019029 Nonsense 219 463 8 13
ENSDART00000099043 Nonsense 237 481 8 13
ENSDART00000145681 Nonsense 237 481 9 14

The following transcripts of ENSDARG00000006370 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 30526468)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 30828103
GRCz11 2 30811636
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGCAGCAWCAYGGCAGTGCKGAGCAATAAGTGTGGCTTCCAGCTGCAGTA[T/A]CAGATGATCTTCTGCGTGTGGCTCCTGGCATTYAGCCCGCAGCTCTGCGA
Associated Phenotype:
Not determined