Busch Lab

ZMP

crlf1b

Ensembl ID:
ENSDARG00000006368
ZFIN ID:
ZDB-GENE-080108-1
Description:
cytokine receptor-like factor 1b [Source:RefSeq peptide;Acc:NP_001107074]
Human Orthologue:
CRLF1
Human Description:
cytokine receptor-like factor 1 [Source:HGNC Symbol;Acc:2364]
Mouse Orthologue:
Crlf1
Mouse Description:
cytokine receptor-like factor 1 Gene [Source:MGI Symbol;Acc:MGI:1340030]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa6708 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa6709 Nonsense Mutation detected in F1 DNA Not yet available
sa30729 Nonsense Mutation detected in F1 DNA Not yet available
sa37503 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa43828 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa6708
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007321 Essential Splice Site None 416 1 9
ENSDART00000110027 Essential Splice Site None 412 1 9
Genomic Location (Zv9):
Chromosome 22 (position 21474706)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 21127954
GRCz11 22 21152932
KASP Assay ID:
554-4493.1 (used for ordering genotyping assays)
KASP Sequence:
CTTTTGAGGCGTACTCTATATTGATTCCTCTCCAAAATTGAGAGTGAAGG[T/G]AAATCTGAGCGTCCTCTTCGCATAATGATGCTTTTCAGAAGCAGCAATGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6709
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007321 Nonsense 93 416 3 9
ENSDART00000110027 Nonsense 89 412 3 9
Genomic Location (Zv9):
Chromosome 22 (position 21476865)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 21130113
GRCz11 22 21155091
KASP Assay ID:
554-4827.1 (used for ordering genotyping assays)
KASP Sequence:
AAATAACAGCTAGGTCCTTGTACTGGACACTGAATGGGAGACGCTTGGCT[A/T]GAAACACGTACAGAGTCCTGAGCCAGACCGAATCGAGTGTCACACTTCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30729
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007321 Nonsense 126 416 3 9
ENSDART00000110027 Nonsense 122 412 3 9
Genomic Location (Zv9):
Chromosome 22 (position 21476964)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 21130212
GRCz11 22 21155190
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATCAACTCAATGGCTCCTTGCAGCAGTCAGGAGATAATCTGGTTTGCCAT[C/T]GAAGTAATGGAGAAGTGCTGGCCGGGTCCTGTCTTTATGTCGGCTGTGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37503
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007321 Essential Splice Site 348 416 7 9
ENSDART00000110027 Essential Splice Site 344 412 7 9
Genomic Location (Zv9):
Chromosome 22 (position 21482804)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 21136052
GRCz11 22 21161030
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TATATGGAGCGACTGGAGCCACTCAACTGCCGCATCAACTCCTGGCATTG[G/A]TGAGTTAATAGCAAAATTCATCCCCTTTACTTCACATTAGACTTCTGCGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43828
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007321 Essential Splice Site 409 416 8 9
ENSDART00000110027 Essential Splice Site 405 412 8 9
Genomic Location (Zv9):
Chromosome 22 (position 21486184)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 21139432
GRCz11 22 21164410
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACGACCAATGGCGCGTCTGGCTGCAGAAAGCCCAGAAAACACATGATCAG[G/A]TCAGTAAAAAAAGACACACATCAAGACTCCACACAATCAATGTTGGCACA
Associated Phenotype:
Not determined