Busch Lab

ZMP

itga5

Ensembl ID:
ENSDARG00000006353
ZFIN ID:
ZDB-GENE-031116-52
Description:
integrin alpha-5 [Source:RefSeq peptide;Acc:NP_001004288]
Human Orthologue:
ITGA5
Human Description:
integrin, alpha 5 (fibronectin receptor, alpha polypeptide) [Source:HGNC Symbol;Acc:6141]
Mouse Orthologue:
Itga5
Mouse Description:
integrin alpha 5 (fibronectin receptor alpha) Gene [Source:MGI Symbol;Acc:MGI:96604]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa13598 Nonsense Available for shipment Available now
sa44025 Nonsense Mutation detected in F1 DNA Not yet available
sa13837 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa13598
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018301 Nonsense 308 1053 10 30
ENSDART00000103275 Nonsense 290 1035 10 30

The following transcripts of ENSDARG00000006353 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 33713431)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 33573229
GRCz11 23 33499760
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTTCCATTCTCAATAGCTCTCTGGATGTGCTGAAGATGTTCACTGGTGAA[C/T]AGGCAAGTTTGATGGCTTTCTGTWTTATTGATGCTTTTCCAAGATTAAGT
Long Flanking Sequence:
TTTGAAAGGAAGTGTTATTATTATACCCTTTATGAATCCATTTCACTTAAACAAATTTCCAAATAGAGCCCTTAAGATTGACTTAGTGCGCCTGTGATCGCCAGAATTCTCTGAGTTCCTGAGGAACCCACTCATTTCCATGTTTCCACTACTAAATCTTTCTCTTTTTCCTCTCTTTGTTTGGCTCGCCTGCGTTCAGACTTTGTGACTGGAGTTCCCAGGGGAGTCAGACTGCATGGACAGGTGAGAGAAAACAGTCACAACATCAACTCTGACATTTAGCCAGAAACATTTCCATGTAAAATATGGACTTGCGTATTCACAGTTTATCAATTTAAAAAAATGTGATAACATTTCTTAAATGTTGTCAAAAGTGATTAGTTTGTTGTTCAATGGTTGTGGTACTTGATGAGCAAATTGTAAAATATGTTCTCTTTTTTTAAAATCAGGTTTCCATTCTCAATAGCTCTCTGGATGTGCTGAAGATGTTCACTGGTGAA[C/T]AGGCAAGTTTGATGGCTTTCTGTTTTATTGATGCTTTTCCAAGATTAAGTGATTACAGGAGATTTGAGATGTTTATTCATGTTTATTTTGTGCTATAACTAGGCCCAAATAAAATCTTCTCTCACGGAAATACAGTTTTTTTGAGCGCATTGTTAAGTCCATTTGCTTTTTTATGTAAATGTGTGTACATTTATACTGTATTTATTAAGGTTTTATATTAATTTCAATAAGATAATAAAACATATGGTAACATTTAGATGATTTGTGTTTAGTATAGTTTGTAAAGCAATAATATCTGTCTTTTGGTAGATATATTGTATAAGTTATACTGTAGCTGTGTTGCCAGATAAGTGATTCTAAGGGCGCACTCACACTATGCTATCTGAACCGTGCCCAGGCCTATTTCCCGGATCGTTTGAGAATTGTGAGTGGTCTGAATCAAGCTCGGCAGCCTGGTTGAAAGAGGTGTGCCAGAGCGTGGTTCACTTGGGCTCAGCTTG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa5062
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018301 Nonsense 624 1053 18 30
ENSDART00000103275 Nonsense 606 1035 18 30

The following transcripts of ENSDARG00000006353 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 33698155)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 33557953
GRCz11 23 33484484
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AATCCTCAAGCAGCAGCAGACAGGCACGGWCTGCRGCCCATCCTCAACTA[C/G]CAGACGGCRGAGCTCATTGAACAGAAAGTACGTACATCTGCTGCTGCTCC
Long Flanking Sequence:
CATATCACTACTTGTATTTCGATGCATACAGAAATAAATATCTTTAATGCTAATACTGTGCCATGAGACACTGTTACAACGCTAGGTATTATTATTAATCATTAATAAACTTGTGAAGGTTTTTTTGTGGTTTTTATGTACATTTTATAAGGAACAGTGCTGTGAGGCAAAGAGAATTAAGAGTACGGTGAGCTAAACAGTGGAAAAATGAGCTGTTTTAAGTGAGTTTTCCATTCCTTGATTCAGCACAAGTGTTAAAAGTGAGGATAAGCAAGATGAGTGTGGCAACTGACGCCAAAAATGCAGCGCGAGATTAAGAGTGTCATTTCGTCCTGCTTTGTGACCTTTCTCACAAACTCCCGCTCTGTTTTCCTCTCCGCCGGAGTGTAGGATGAGAAGGACTTCAGGGATAAACTGTCTCCCATCTTCGTTGCTCTGAACTTCAGCCTGAATCCTCAAGCAGCAGCAGACAGGCACGGACTGCAGCCCATCCTCAACTA[C/G]CAGACGGCAGAGCTCATTGAACAGAAAGTACGTACATCTGCTGCTGCTCCACATATCCCACAAAGCGTTACATGAACAGTCATATTACATGGTGTGGTATAGTGTTGTCATGATACTGGAATTTCTAACTAAAACTACTATATTCTATACTAACTATCTAACTATCTAAAAATAATCAACACCATATTATTTGATACCAATTTTGATACCACAGAGAAATATTGCAGCAGTATAAATTAAATTGACACATTTTGTGCTTGTCTTTTGGTTTAAAACCAAAATCATGGCCCAGTGTTAAAGAAACACTCTACTTGTTTTAAAAATAGGCTCATCTTACAACTTATCTAAAGTTCAACTTTTGAGTTTTAACATTTTTTAATTCATTCAGCCGAACTCAAGGACTGGCGAAAGCAATTTTAGCTTAGCTTAGCATAAATCATTAGCATGTCACTCAAAAATGACTAAAGAGTTTTGATGATTTTCCTATTTTAAAGCTCGAC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29978
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018301 Essential Splice Site 633 1053 18 30
ENSDART00000103275 Essential Splice Site 615 1035 18 30

The following transcripts of ENSDARG00000006353 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 33698127)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 33557925
GRCz11 23 33484456
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GACTGCAGCCCATCCTCAACTACCAGACGGCAGAGCTCATTGAACAGAAA[G/A]TACGTACATCTGCTGCTGCTCCACATATCCCACAAAGCGTTACATGAACA
Long Flanking Sequence:
CAGAAATAAATATCTTTAATGCTAATACTGTGCCATGAGACACTGTTACAACGCTAGGTATTATTATTAATCATTAATAAACTTGTGAAGGTTTTTTTGTGGTTTTTATGTACATTTTATAAGGAACAGTGCTGTGAGGCAAAGAGAATTAAGAGTACGGTGAGCTAAACAGTGGAAAAATGAGCTGTTTTAAGTGAGTTTTCCATTCCTTGATTCAGCACAAGTGTTAAAAGTGAGGATAAGCAAGATGAGTGTGGCAACTGACGCCAAAAATGCAGCGCGAGATTAAGAGTGTCATTTCGTCCTGCTTTGTGACCTTTCTCACAAACTCCCGCTCTGTTTTCCTCTCCGCCGGAGTGTAGGATGAGAAGGACTTCAGGGATAAACTGTCTCCCATCTTCGTTGCTCTGAACTTCAGCCTGAATCCTCAAGCAGCAGCAGACAGGCACGGACTGCAGCCCATCCTCAACTACCAGACGGCAGAGCTCATTGAACAGAAA[G/A]TACGTACATCTGCTGCTGCTCCACATATCCCACAAAGCGTTACATGAACAGTCATATTACATGGTGTGGTATAGTGTTGTCATGATACTGGAATTTCTAACTAAAACTACTATATTCTATACTAACTATCTAACTATCTAAAAATAATCAACACCATATTATTTGATACCAATTTTGATACCACAGAGAAATATTGCAGCAGTATAAATTAAATTGACACATTTTGTGCTTGTCTTTTGGTTTAAAACCAAAATCATGGCCCAGTGTTAAAGAAACACTCTACTTGTTTTAAAAATAGGCTCATCTTACAACTTATCTAAAGTTCAACTTTTGAGTTTTAACATTTTTTAATTCATTCAGCCGAACTCAAGGACTGGCGAAAGCAATTTTAGCTTAGCTTAGCATAAATCATTAGCATGTCACTCAAAAATGACTAAAGAGTTTTGATGATTTTCCTATTTTAAAGCTCGACTCTTTTGTAGTTATGTTGTGTACTAAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44025
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018301 Nonsense 909 1053 26 30
ENSDART00000103275 Nonsense 891 1035 26 30

The following transcripts of ENSDARG00000006353 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 33672033)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 33531831
GRCz11 23 33458362
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGGGCACGAACACCACATTGAGAAGCGGGACACGCACAAGGGAGAGCTCT[C/A]GCAACTGACCAATCTGGTGAGATTTCTGAAGTTGTGAAATAAAAGTGATG
Long Flanking Sequence:
CAGGAATCAGCTATAAGACATTTTAGAAGCCTGGATAAACCCCTTTCGGCCCATTTTGAGGACGTCCTGACCAAGTCTAGCGGATTGGTAACGCAAAACTGCTGTTGCATCTGGGACTGTGCTGAATTCTTCCCTGAATTAGCTGTTTGTTCAGTTTCTCATGCCATTTAGGGCGTACTTCTTGGTTTGGAGGAGTGCATGGCTCTGCACAATGGAGAAGTTGAGTAAAATCTGACATCTGTTGCAAAATGCCCCTTGCGTCCAGCTCAACGTGTCCCTCCCAGCTCAGTGTTAGCGTTGAGTCAGAGGGCGTCAGTACAGACTGAACCGTGATGTCAGAGTCCACAGTGTCCAGAAGTGTGTGGTGAATTTCCACTTAATGTTCCCTTCTCTGTTTCTCTCTCTTCAGCTGCAGCAGTCTTCAACAGAGCAGCCTCCTGTACGAGATTCAGGGCACGAACACCACATTGAGAAGCGGGACACGCACAAGGGAGAGCTCT[C/A]GCAACTGACCAATCTGGTGAGATTTCTGAAGTTGTGAAATAAAAGTGATGAAACAAAGCAAAACATGAATAAAACATTAACTCTATTCTGAAAGGGATAGGTTGACTGGATGAGTCCTGTTTTGCAGCTTTATTTTAGTGTTCAATCATCCCACACGAACAAATACTACAGTAAATACTAAAATACTTGAATTCATCTGTTGTGGTAATTCCATAGCTCAGGGGTGTCAAACTCAATACCTGGAGGGCTGCAGCCCTGCACAGTTTAGTTCCAACCCTAATTAAACACACCTGATCAAACTAATTGAGTCCTGAAGGCTTGTTTGAAACCTACAGGTAAGTGTGTTGGAGCAGGGTTGAAACTAAACTGTGCAGGGCTGCGGCCCTCCAAGAATTGAGTTTGACATCCCTGCTATAGCTGCTGTGGTTATACAACAACTATATAATACAAACTAATGATCCATTACTATACTCAGTTTTTGACAACTATATGGTTTATAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13837
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018301 Nonsense 931 1053 27 30
ENSDART00000103275 Nonsense 913 1035 27 30

The following transcripts of ENSDARG00000006353 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 33667088)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 33526886
GRCz11 23 33453417
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GTCTTGCTCCAGTGTGGACTGTTGGACTCTBRTGTGTAATGTWGGCCTGT[T/A]GGAGCGAGGGACKAGTGCCATACTTCMTGTTCGCTCACGAATTTGGGCTG
Long Flanking Sequence:
TTGCTACGTTTCAGTGGCATTTGTTTATTTGAATAACAGCTCTCATGAAGGGTTTACAGTGGCTTCTGACAGGAACTAAAAATGCTGTGTGATGAAATACACTCGGCTCCACACAATACCTTCATATTGTCTCAACACAAATTGATTAAGTTAATAGTTTTTACAAATTTAAGTGGATTGAACATAAAACAATTAAGTTATTAAGAATTATTGTGTTTTAGCTCATTTTAAATAACAAACAAGCAGCAATAACATAGAAAACTTCATTATAATCATTATAAATTCCAAAATAGTTTGAATGTTTGGTAAAAATGCAGGAAAAATCTGTGATTTTGTTTGTTTTCTTTACCCTAAAATATTTCTCTTTCTTTTTGACTGAAAAAATAAAATAAGCAAAAGCAAATTTTGAAATTGATGTTACTCCGTTGTATCTCCTTGTCTGTTGTTTTAGTCTTGCTCCAGTGTGGACTGTTGGACTCTGATGTGTAATGTTGGCCTGT[T/A]GGAGCGAGGGACGAGTGCCATACTTCATGTTCGCTCACGAATTTGGGCTGAAACGTTTATGGAGGTGAGCAGAAAGTGTTGTCTCTTGAAATGATTACTAATAGTGCACTGAAAACAAAATGATGGATGCTTTTACAGTCAAATTTTATACTCTGAAATCTCAAATAAGACCCCTCTCCAAGTCCACCTCAATGATTGAACAGATTAAAAATTTAGTGTATAGTGTGGTTATTTCCTGATATATTTTGTAGGTAGTAATGTAGATTTGGTGGTGTCTGTTTAACTCAAGTTGAAGAGAATCAGATGGTGTGTAAACAGGAGCTCTTTTGAGAGACTCCTTACATGCAGCTCCAGCCAATGCAAAGTTTATAAGCCAGTGCATTGAAAATACATTAAGAGAAGTCCTGAGAGCTCAGCGCATTGGAATGTCAGAAAATGTTGGGATCCAGTGAAGCAATACTGCCACCATCTGGATGCGACTAGGACTGTTACATTAAAAA
Associated Phenotype:
Not determined