Busch Lab

ZMP

itgav

Ensembl ID:
ENSDARG00000006314
ZFIN ID:
ZDB-GENE-060616-382
Description:
integrin alpha-V [Source:RefSeq peptide;Acc:NP_001028893]
Human Orthologue:
ITGAV
Human Description:
integrin, alpha V (vitronectin receptor, alpha polypeptide, antigen CD51) [Source:HGNC Symbol;Acc:61
Mouse Orthologue:
Itgav
Mouse Description:
integrin alpha V Gene [Source:MGI Symbol;Acc:MGI:96608]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa31703 Nonsense Available for shipment Available now
sa41365 Nonsense Mutation detected in F1 DNA Not yet available
sa34569 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa31703
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044314 Nonsense 110 1045 3 30

The following transcripts of ENSDARG00000006314 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 11922213)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 11674778
GRCz11 9 11645981
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTTCCTCTTGTTTTTTCCCCGTCACAGATGACAGAAAGCATTCCAATGGA[C/T]AGCAAATGGAGTTTAAGTCAAATCAATGGTTTGGTGCCACTGTGCGTTCC
Long Flanking Sequence:
AGTGTTCCTTTTAAATTGAAATTCAGTATTGTCATATTCACTTTGGGCCTATAACTATAACTTTTATTAATGTCTCTGCAAGGTTTCAAGTTCATTGTGCTTGTTAACAGCAGGAAAGATTATATGTTTGATTCTAGCTTACCATGAATAGATTCAGCTGTCAGTTTTCATGACCTTGGATTGAACTCTGCATGGTTGGTTCTTGTGATGTGCTGCAATCTCCCATCCTCTTCATATCAGCTCATCTTTTTGTTCTTTTTGATCAAACTCTGATGCTTGTGTCAAGTCAGAGCTTTTGAAATCTGCTTTAATTAGAGGCACACTCTTTGGATGTGGTTTTTAATGAGTGGAAGAGCAGTGTAGTACACTAGAAAGAATACAATGACAGGTTGATGAATCAGTATTTGCTGACAAACTTATATTTCTGTCTGCTTCAGTTCCCTGTTCTCACTTCCTCTTGTTTTTTCCCCGTCACAGATGACAGAAAGCATTCCAATGGA[C/T]AGCAAATGGAGTTTAAGTCAAATCAATGGTTTGGTGCCACTGTGCGTTCCTCTGGGGACCAAATTCTGGTGAGTCTGCATGTATAGGGTGGAAAAAAAAGAAATGCAACCTGAATAAAAACATCTGCAATATTGACACTTCTTTATATTGGGGAAAGTATATATATTTTTATTAAGACATTTTCTATATATCCTAATAAAATCAAACATGGCTTTATATTTTCCAGTAAGTACACGCACATATATACTATACATACACTGTAAAAATACCCATTTTATAGTAGTATTTCTGTATGCCGTCTGCATTTTGTGATTTGCGAGTGTTTTCTGTTTTTGTAAAGTTATGAATTGCATTATGGGACCTTGATCTCTGCTCTATTTCAACTCTGCAGACTTTAATTGACATTTTAGTATTTGAAATACAATATTGTATAAGAAATTGTAATATAAATAGATACATCTGTAAAATAATAGTAAAAGGAACTGGGTGCTTATTACCTG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa2542
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044314 Essential Splice Site 296 1045 10 30

The following transcripts of ENSDARG00000006314 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 11908460)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 11661025
GRCz11 9 11632228
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTTTTAACGGGAGGAACATGGAGTCGATGTATAACTTCACAGGGACACAG[G/A]TGGGTGTAATGTGTCCAAATGCTGTCTATCGGGAGGTGTGTTTTAGGAGA
Long Flanking Sequence:
TTAGTTAGCACAAGGCTTTGTTCCAAAACAAAAATGCACAAAAAAAAAATCCTACTGACCTTTAGCTAAATGGTGGCATAATTATAAGCAACCACGTGTTGTAATTAGCCTGATAAATCTAGTCTTTACTGACCTGCTCTAAATACCAGCCCCATACCAAAGCAAACTGAAATATTTTTATGGGAATTGCTCAAATCTGATTTTTCTTTGCGTTAGGATCAAGAAGCTTCACCGCTGAATGAAAGCATTGTTGTGTCCAGTTCATTGCTAACTCTTTTTGCCTCCCTAGATTATGTCACTGGAGTTCCTAGAGGGGAGAAGGCTCTCGGATATGTGAGTTTAATACTATTTATGGTCAAGAACCTGATGAAAAAACTCATAAAAGTGATGCAACCCTGCATGAATCAGCTTGCACGAATCTATGTCTGGTTGTGTCTTGTTAGGTCAACATTTTTAACGGGAGGAACATGGAGTCGATGTATAACTTCACAGGGACACAG[G/A]TGGGTGTAATGTGTCCAAATGCTGTCTATCGGGAGGTGTGTTTTAGGAGAGAAAAGCATGTTCAAGCGGTCTTGACTATGAACAGCCTGCAGGTCACATGACATGCCCATGCTTGTGGTCATGGCACAGTTATGTTTAACATTTGTTTACGAGCCGAGAGTTTATGTCTTAAATCCACTCCCACATCTGGAAGCCATTGACAGCAGTGTCGCCAACATATGAGCGCAAGAGGGAAAAGGATGAGGCGTGGTGCAAAAGGCATGACTTTTTGGCTGATTGTGATTACTGTAGTGGTGATTCATCAACAGTTCATTAAGCTGGATTCAACAAGCTCAGAAATTACATCTAGAAAAGAGGCACTATCATTACAAAAAATAATAATAATGGCTTGAAACTTTTATGTAGACATATTATTAGTTTAAATGCAGATTTTTTTGAGACTAAAGCTAGTCATGACTAAAAAATTTTTCTGTTTTTTTAGATGGCTGCTTACTTCGGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41365
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044314 Nonsense 371 1045 12 30

The following transcripts of ENSDARG00000006314 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 11904306)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 11656871
GRCz11 9 11628074
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATCAAACTCACCGGCTCCGAGATCTATGCTCGATACGGAAGCTCAGTCTG[C/A]AGCGTGGGAGACCTTAACATGGACGGATATAACGGTATCATTTTGACTCC
Long Flanking Sequence:
TCTGTCAGCACCGAGTAAACCTACCCTAAAAATATGCACAGCAGCTTTTTGAGAGCATTCACTGGCAGTATTTCAGAAAATGAGCTGTAATCTGAACATTGTGCAACAGCGAAGATAAATTTACCTTCGTTTCCCCCTCATGTTTCTCTTTGTCTGAACTTGTTGCCCATTTTTGTGTTCAGAAAGACCTGCATCATATAAGTACATGTGAAGCCTTTTTTAAGCAACTCTTAAACGCATATAGATTTTGATCAAAGTTAGACTGCTTGTTTAAACACTGTGTATATCGATGATGTGTTCCAATGGCATAAATCTTGTAACCTCCTCAGGAAAATGGATTTGTTTGTGGGGGCTCCTCTATTTATGGACCGGGGCTCAGATGGCAAACTGAGGGAAGTGGGTCAGGTCTATGTCTACCTAGGAAAAGGTGGCTTCACCTTCAACAGTGTCATCAAACTCACCGGCTCCGAGATCTATGCTCGATACGGAAGCTCAGTCTG[C/A]AGCGTGGGAGACCTTAACATGGACGGATATAACGGTATCATTTTGACTCCTCTCGATGTGTTCACTGTGTTTATTCAAAACAACTTGCTTGCAACATAGACAGACAACCAGCACTTATATGGTCATTTGTGGTCAGAGGCTGTCACTGTCTTCCTGACCACATCATGCAACCGTAGTCATGAGTCAGGAGCTTTTTGAGCAACGTCTGTACTAACGGCTAAGAACACAATACTCCTCATGGTGGTTACTCAATGACTGTGACTTAGATTGTTTTTATGCTTAATCCCTCTGTTTTCCATGTGGCTTTTTGCAGATGTGGCCATTGCTGCTCCATATGGTGGGCCGTTCCACCGCGGCCTGGTGTACATCCATAATGGCCGTTCCACAGGGCCCAATCCTGTGGCCTCTCAAGTTCTGGAAGGAACATGGGCATCTGTGTCCATGCCATCCAGCTTTGGTTATTCCATGAATGGAGGCACCGATGTGGATCAGAATGGATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34569
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044314 Essential Splice Site 637 1045 20 30

The following transcripts of ENSDARG00000006314 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 11892445)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 11645010
GRCz11 9 11616213
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGATGATCTCCGTGTGCATCTGTCCGTTTGATGTTCTTTTTCTTGCACCA[G/T]TGACCAGAACGAGATCTACATAGGTGACGACAACCCACTGACCCTGGAGG
Long Flanking Sequence:
TTTTTTCTAAAATATTTATTTTCATTGTGGAAAAAGTGTACTTCGGTCTCTTCAGTGGTGGAAATGATTTGCAGATTGGCCCAAATTGGGCTCAAGTGAATCAGTTTGAATTATTTTAGATATTAATATTGAAGTTGAATCTCAAACCGCTTAAAAACCAGTTGAAAGTCATTGGATAAAAAAAGGAAGCGTGTGAACCCTGGATTAAATAAATAGTACAGCGTTCACTCAGAAGATAAAATCTTGCATTCTCATTTAAAAAAAAGCTTTGCATAAAAATAGGAACAAGTTTTAATTTTCCCATGTTTTGTAATTTTTCCAGGCTCACATACTCCTGGATTGTGGCGAGGACAATATCTGCAAGCCAGACTTAAAACTGTCTGTGGTGAGGTGAGTCAGAGGTTCATCTGAGCCCTAAATTCCAGTGTATTATCAGTCGGTGTGAGCTGGAGATGATCTCCGTGTGCATCTGTCCGTTTGATGTTCTTTTTCTTGCACCA[G/T]TGACCAGAACGAGATCTACATAGGTGACGACAACCCACTGACCCTGGAGGTCACAGCAGAAAATGGAGGAGAAGGGGCATACGAGGCTGACCTGATCGTCACTCTTCCATCACAGGCCGATTTCACTGCGGTCGTGCGTAACAGTGAGGTGAGCAGTGACCCCTGTGCAACTATTAAAGTGTGACCTTTCATAATGAGGTTTGGAGCTTTTAAAGGGTTGTTCTGGCTTTAATCACACGTTCAACTCCATGAAGAGTATGCTTAGTTTGTTGAGACTAGCCAGAATTGTTGGGTAAATGTAGTCCTAAAGCTTGGGGCACACCTTTTTATTTTCAAAGAATTAGCAGTGATGAAAACTGACTGTATTGTTACTTCACGTCTGTTGGGTCTGGTCTCATCTGGAACAAAAAGTTGCGCGTAAACATCAAACGGCTGACTGAAACGAGTTCATACATTCTGTGCCTGTGTATCTTTTCATACCTGCAGATGGCAGTATTTGT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa5526
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044314 Nonsense 982 1045 29 30

The following transcripts of ENSDARG00000006314 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 11877343)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 11629908
GRCz11 9 11601111
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GGTCATCAGTATCTTTCTCCTGTAGGCGTCCCTGAAGGTGATCTGGAATT[C/A]GGAGAACCCTCAGCCTGTCCCGGGATGGGTTGTGGCTCTGGCTGTTCTGG
Long Flanking Sequence:
TGGAAGAACGTTGGGAAACCTGTAACCATTGACTTGAATAGTATTTGTTTTTCCTACTATGGATGTCAATGGTTACTGGTTTAAAACATTTTTTTTTTAATATTGTCTTCTGTGTTTAATAGAAAACATGAATATATAAAACTGTGGAACCACTTATGGGCAAGTAAATAAACTGTATATTTTGATTTTCGGGTCAACTATCTCTTTAACTAATACCTTCAAATCAACGTGCCAAACACTGGATGGTTGACATTCAGCTTTCAAATGTACAGCAGATACAAAGAAAGTAATTAAGCACATAAATAAATAAAACTATTTTATCCTAGAATAAAAGGAGAATAAAGTCCTCTATCAAACCAAAACTACAGTTAAAGTGTATGATGGAGAAAAGGACTTCATATTTGCATTTATTTTTTTTGTATTAGATGTGTAGTGTTTGTTGATATGATTGGTCATCAGTATCTTTCTCCTGTAGGCGTCCCTGAAGGTGATCTGGAATT[C/A]GGAGAACCCTCAGCCTGTCCCGGGATGGGTTGTGGCTCTGGCTGTTCTGGCTGGACTGCTGCTTCTGGCTCTGCTCATCTTTGTCATGTATAAGGTAAACAACTGTAGACTTGAGTTAAATCACACAACCGTCTCTGTGGGTATGACATCTGAATATGAATGAATGAAATATTGACATTACAGTCGAAATTATGTGAATGTATTTTTATGAAAAATTATTTCAGTTGGATAAATCGATGTTTAAAAATATTAAATAATGAACATACAAATTGATGGATGCATAGATATAGTTGGATCATAAAGGGATGAATGGTGGATGGATATAGATATATGATGGATGGATATTGATGTTTTTGTTTTGATAAAGATAGATAAAGCATTGGTAGAAGAGGACTGTTGTATTAATGGATGAAAAGATGAAGATGGATTAATGGATCTGTATATAGAGAGAGGATAGGTGGATGGATGGATATAGATTAAAGATGGATGGGTGGACATAA
Associated Phenotype:
Not determined