Busch Lab

ZMP

arhgef7a

Ensembl ID:
ENSDARG00000006299
ZFIN ID:
ZDB-GENE-060322-11
Description:
Rho guanine nucleotide exchange factor (GEF) 7a [Source:RefSeq peptide;Acc:NP_001116707]
Human Orthologue:
ARHGEF7
Human Description:
Rho guanine nucleotide exchange factor (GEF) 7 [Source:HGNC Symbol;Acc:15607]
Mouse Orthologue:
Arhgef7
Mouse Description:
Rho guanine nucleotide exchange factor (GEF7) Gene [Source:MGI Symbol;Acc:MGI:1860493]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa9534 Essential Splice Site Available for shipment Available now
sa8972 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa13978 Essential Splice Site, Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa9534
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045093 Essential Splice Site 649 861 16 23
ENSDART00000141408 Essential Splice Site 648 858 16 22

The following transcripts of ENSDARG00000006299 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 22595173)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 21750959
GRCz11 9 21561828
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GCGTCCAGCGCCTCCACTCAGGCCCTCAGCTGCTCTCTGTTATAAAGAGG[T/A]ATTRTAAYTTCCACTTACAAATTTAAAATTAGGTATGCAAATATTATTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8972
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045093 Essential Splice Site 711 861 19 23
ENSDART00000141408 Essential Splice Site 710 858 19 22

The following transcripts of ENSDARG00000006299 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 22597189)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 21752975
GRCz11 9 21563844
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TCATTCATATGATTTAAYGCCCCTCTCATCCRTGACCGGACGGCCTCCTC[A/G]GCATGGCAAGGCACTGATCTCATGCACAACCACGTTTTGGATCAGTCCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13978
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Essential Splice Site, Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045093 Essential Splice Site 828 861 22 23
ENSDART00000141408 Splice Site 819 858 22 22

The following transcripts of ENSDARG00000006299 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 22599400)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 21755186
GRCz11 9 21566055
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ACATTGATATKTYTGTTTCCTAGTTAACRGATTTTAACCTTTCAACAGGA[C/T]TATAAAAAAATGAAAAAATCCCTGGAGGAAGAACAGAGAGCTCGGAAAGA
Associated Phenotype:
Not determined