Busch Lab

ZMP

prdm5

Ensembl ID:
ENSDARG00000006288
ZFIN ID:
ZDB-GENE-040708-1
Description:
PR domain zinc finger protein 5 [Source:RefSeq peptide;Acc:NP_001002301]
Human Orthologue:
PRDM5
Human Description:
PR domain containing 5 [Source:HGNC Symbol;Acc:9349]
Mouse Orthologue:
Prdm5
Mouse Description:
PR domain containing 5 Gene [Source:MGI Symbol;Acc:MGI:1918029]

Alleles

There are 8 alleles of this gene:

Allele Name Consequence Status Availability
sa37594 Nonsense Available for shipment Available now
sa24242 Nonsense Available for shipment Available now
sa31079 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa14875 Nonsense Available for shipment Available now
sa7503 Missense Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29862
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127443 Nonsense 52 634 2 16
Genomic Location (Zv9):
Chromosome 23 (position 2056381)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 2024476
GRCz11 23 2034884
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGAAGTTTGGTCCGTTCGCTGGTGAGAAGCGGATGCTGGGTGATCTGGAT[G/T]AAAGCATGGACCCGCGGCTGATGTGGGAGGTGGGTGACCATAGACTCAAC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29861
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127443 Essential Splice Site 102 634 3 16
Genomic Location (Zv9):
Chromosome 23 (position 2052625)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 2020720
GRCz11 23 2031128
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCGTCCATCAGGCCCCTTCACAGGAGCAGAAGAACCTGGCCGCAATCCAG[G/T]TAACAAAAAGACTGTATGTAAGATTAACTACAACAAATGTGAGTTTAAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37594
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127443 Nonsense 109 634 4 16
Genomic Location (Zv9):
Chromosome 23 (position 2047085)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 2015180
GRCz11 23 2025588
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CACTCTGTGTGTGTGTGTGTGTGTTCACAGGATGGAGAGAATATCTTTTA[T/A]CTGGCGGTTGATGACATCGAGACGGACACGGAGCTGCTGATTGGTTACCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24242
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127443 Nonsense 155 634 4 16
Genomic Location (Zv9):
Chromosome 23 (position 2046949)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 2015044
GRCz11 23 2025452
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGGAAGAGCAGGACATCAAAGATGAAGACGAGAACAGTAAAGACAGCAAA[C/T]AACTCAGTGCAGACACAGGTGTGTGTTCAGTGGCTCTCTAAAGGCCTAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31079
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127443 Essential Splice Site 161 634 5 16
Genomic Location (Zv9):
Chromosome 23 (position 2043660)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 2011755
GRCz11 23 2022163
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCAAAGCTCATATAGTTCACCAATGTGTGTGTGTGTGTGTGTGTGTGTGT[A/G]GAGCTGATGATCAAAAAGGAGGATTACCCATGTCTGCTGTGCGAGAGCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14875
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127443 Nonsense 347 634 9 16
Genomic Location (Zv9):
Chromosome 23 (position 2027417)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 1995512
GRCz11 23 2005920
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TAAAAAGTTCATCTCCACCAATCAGCTGAAGAGACACATGATCACACAYT[C/A]AGGTAAATTCACACACTAGTAAAGGTGATGATACACAGGCGACTTTAMAA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4207
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127443 Nonsense 376 634 10 16
Genomic Location (Zv9):
Chromosome 23 (position 2025422)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 1993517
GRCz11 23 2003925
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GCAGCTTTAAGCGTCTGGATCAGGCCACGGCTCACAAGATCATCCACAGT[G/T]AGGACAAACCGTACAAGTGTAAGCTCTGCTGGAAGGAGTTCGCCCATCGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7503
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Missense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127443 Missense 467 634 12 16
Genomic Location (Zv9):
Chromosome 23 (position 2009948)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 1978043
GRCz11 23 1988451
KASP Assay ID:
554-4281.1 (used for ordering genotyping assays)
KASP Sequence:
ACTCAACGTGCACATTCARGTGGTTCACGACGGACACAAGAAGTACAAGT[G/A]TGACCTGTGTGAGAAGGCCTTCGTCACGCCGTCYGTGCTCAAGAGCCACA
Associated Phenotype:
Not determined