Busch Lab

ZMP

MYH11 (2 of 2)

Ensembl ID:
ENSDARG00000006281
Description:
myosin, heavy chain 11, smooth muscle [Source:HGNC Symbol;Acc:7569]
Human Orthologue:
MYH11
Human Description:
myosin, heavy chain 11, smooth muscle [Source:HGNC Symbol;Acc:7569]
Mouse Orthologue:
Myh11
Mouse Description:
myosin, heavy polypeptide 11, smooth muscle Gene [Source:MGI Symbol;Acc:MGI:102643]

Alleles

There are 7 alleles of this gene:

Allele Name Consequence Status Availability
sa38402 Nonsense Mutation detected in F1 DNA Not yet available
sa20079 Essential Splice Site Available for shipment Available now
sa33243 Essential Splice Site Available for shipment Available now
sa33244 Nonsense Available for shipment Available now
sa26113 Nonsense Mutation detected in F1 DNA Not yet available
sa18760 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa38402
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004854 Nonsense 50 1961 1 40
Genomic Location (Zv9):
Chromosome 3 (position 36482606)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 36566498
GRCz11 3 36708356
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGATGGTGTGGATTCCCTCAGAAAGGGATGGTTTTCAGTCAGCCAGCATT[A/T]AAGAAGAGACGGGGAATGAGGTGGTGGTGGAGCTGGACAACGGGCAGAAG
Long Flanking Sequence:
CTTAAAGGGGCTAATAATTTTGACCTTAAAATGATTTTTTTTTTTAATTAAAACTGCTTTTATTCCAAGTGAAATAAAACAAATAAGACTTTCTCCAGAAGAAAAAAATATTATCAGACATACTGTGAAAATTTCCTTGCTCTGTTAAACATCATTTGGGGAATATTTAAAAAATAATAATAAAAGGGGGGCTAATTATTGTGACTTCAACTGCATGTTTCTAATATCGCCTGAATAACATAAGCTTGCTTCACACTGAAGAAATATCATTCTTGATTGAAATATTTTTTGTAAAAAAAGTCAAATAATGAATTGACTTTTAACCACAGAATAACTCACAGAAGTTCTTCAAGATGACCATGCAGGACAACGATGACAGCAACAAGTTCCTTTTCCTGGACAGTGAGTTCAAAAACAGTGGGGTGGCTCAGGCTGACTGGTCCACCAGAAAGATGGTGTGGATTCCCTCAGAAAGGGATGGTTTTCAGTCAGCCAGCATT[A/T]AAGAAGAGACGGGGAATGAGGTGGTGGTGGAGCTGGACAACGGGCAGAAGGTGACCGTCAGCAAAGACGACATTCAGAAGATGAACCCACCCAAATTCAACAAGGTTGAAGACATGGCTGCTCTGACCTGCCTGAACGAGGCTTCAGTGCTGCACAACCTCAGGGAGAGGTACTTCTCAGGCCTTATTTATGTAAGTGCATTCAATAATCACCATATACAGACAGATAAGTGATTACACAGGGTACATGAATTTAGCTTTTCTCTTTCTGCAATATGTGAAAACTGAAAAACATGGTTAGTATCAAATCTGATTTAAATGTTTTCCATTTAGTTTTAGAGATTTGGTTTAAAAATATAAAAGTGAATCTGTAAATGTCAAATATGAATGGATGGATTTGTTTGAAAAATTGAAGAAAAATTAAATGACTGATTTTTCTAAGTGTGTTTAAGTAAAATGGCAATATTGATTTTATTTATGAAGGTCTGATTACATTTCTTT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26112
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004854 Essential Splice Site 240 1961 6 40
Genomic Location (Zv9):
Chromosome 3 (position 36488856)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 36560248
GRCz11 3 36702106
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTGTTGATTACCTTTATAATCAACTAATAAAGAATGCTCTTAACTTCTCA[G/T]GGTAAATTTATCAAAATCAACTTTGACAACACCGGCTACATCGTTGGAGC
Long Flanking Sequence:
TATTATATTATATTATATTATATTATATTATATTATATTATATTATATTATATTATATTGTGTTATGTTATATTATATTATTTTATGTTATATTATATTATATTGTTTTATGTTATATTATATTATATTATTTTATATTGTGTTATGTTATATTATATTAAATGATATTATATTGTGTTATGTTATATTATGTTATATTATATTATATTATATTATATTATATTATATTATATTATATTATATTATATTATATTATATTATATTATATTATATTATATTATATTACACTTCATTGAATGGTTGATTGAATTAATTGATTCAGGGAGAGCTTGAGAAGCAGCTCCTGCAGGCCAATCCCATTCTGGAGGCATTTGGAAATGCAAAGACCATCAAAAATGATAATTCTTCAAGATTTGTGAGTTTACACTTCATTGCTTCAATACTGAAAATTTGTTGATTACCTTTATAATCAACTAATAAAGAATGCTCTTAACTTCTCA[G/T]GGTAAATTTATCAAAATCAACTTTGACAACACCGGCTACATCGTTGGAGCAAACATTGAAACGTGTATCCTTATAATCTCTTTCAATTTATAAATAGTTTAACTATCCATCTTACAATAGTAAATTATACAGTCAAACACTCTCACCTTAACATCTCTGAATCCAGACCTCCTGGAAAAGTCTCGCTGTATCCGACAGGCCAAAATCGAGAGATCCTTCCACATCTTCTACTATATGGTGGCTGGAGCAAAAGACAAAATGCGAGGTGAGGACTAGCATGAGTATTTAACATATCTACTTCTATAGCACAGTCTTGTGGAAGTATATAACCTGATTTGGTCAGTTTATTAGATAACTTTATTTACAAAAAAAATGATGCATTTGTTTTCTACTTCCTGAGAGCTCCCGTATAGAAATCGGATGCATGGAAATATATGCAAATGACATAAATGGGCTCATATTTAGATTTCATTTATAAAAATACGAGACATATATTTTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20079
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004854 Essential Splice Site 750 1961 18 40
Genomic Location (Zv9):
Chromosome 3 (position 36495429)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 36553675
GRCz11 3 36695533
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATTAACCTATCTTACCCTTGATGACAATTTCTCCCTGTTTTATGAACATC[A/T]GATTAAACATCTAGACTTGGACCCAAACCTGTATCGGATTGGTCTGAGCA
Long Flanking Sequence:
TCTTAATTATTGATTTCAGGAATAAAATGTTTGATATCAAGAATTAAATAGATGATATCAACCATCAGCATTTTTGATATGAAGAATTGTATTTCTGCAAATGATGACATCATTGTTGATAGAAAATTAACATTGTTAATAGTTGACATGTAATTGTTTTATCTACAGTCAGCATTTTTGATATACTAAATCCTTGATATCTTGACATCATAAAAATGACGTGCCATAAAACTACTTTATATGTCAATAAACTTTAAACTTAGGGCATTAGTAGGCACTTAAGTTGAGGTTTGTAGAATAAATTGATATTAATAAATTTCTAGCTATGAGGTTCTTGCTGCCGGTTCCATTCCTAAAGGTTTCATGGATGGAAAACAATCCTGTACGCTTATGGTGAGTTGAGCAAAATATCTCATTTTACTCTACTGGCAGGGACAATTCAAATGCTATATTAACCTATCTTACCCTTGATGACAATTTCTCCCTGTTTTATGAACATC[A/T]GATTAAACATCTAGACTTGGACCCAAACCTGTATCGGATTGGTCTGAGCAAGATATTCTTCCGCACAGGAGTGTTGGCACAGCTGGAGGAAGAACGAGACCTGAAACTGACTGATATTATAATAGCCTTCCAGGCCCAGGCCCGTGGTTTTCTTGGCAGAAAGTGAGTTCTTGACATGCACATACAGGAGATCAAAATTGCAGAAAGATTTACATAAAAAAAAATAATAATAATAATATTAAGTAGTGTAATACCAGTTTTACCATGCTAGTTGTGTTTTCCACAATTGCACTGTAGTGGCTATTTTGAATGAGTTAGTTAATGTCATTGTAAATAATGAAATATTTTAGAAATCAGATTTGTAATTACCAAATTCTCTGTCTGGCTAGCTGTGAGTTTCTCACTCAGTTTGCCCTAGCCATATCACCAGGCAGCCTAGGGGAACCTATATGAGGTAAACACAAAACAAAACTTTCCATCCAGAGCTCCTTCATGGGACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33243
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004854 Essential Splice Site 883 1961 20 40
Genomic Location (Zv9):
Chromosome 3 (position 36497847)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 36551257
GRCz11 3 36693115
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCCAGAAGTCTGAAACGGAACTAAAGGAGATCACACAGAAACACGACCAG[G/A]TAAAGTCAGATCAAAAATGTGACACAAACTCAGCCGTAATTACTATTGTC
Long Flanking Sequence:
ATTAAAAAAAAGAGGACCAAAGCAGTAAGCTCAAAATGCATAGGCTGTTCTCCACACTGATCTTGACTTTAATCTTCACTGTACATCAGTCACCATCTACTTGAATTTTCTTACTGTATTAACAGTAATCATATTTATCAAAATGCCTCACAGTGGCCATTTTAAGTAAATCTAAAACCTCTAAATTTACAGGGCATTCAGCAACAAACAAAAGCAGTTGACAGCCATGAAAGTGCTACAGAGGAACTGTGCTGTTTATCTGACACTCAGGAACTGGCAGTGGTGGAGACTTTTCACTAAAGTAAGTGTAAAACCCAGCTACACATTATCCATGTATGCTCAAGTACTCAGTTTATTTTCTCCTTTAGGTCAAACCCCTGCTTCAGGTGACTCGTCAAGAAGAGGAGATGAATCAAATAGAAGAGGAGCTCCAGAAAGCCAAAGAAATTGCCCAGAAGTCTGAAACGGAACTAAAGGAGATCACACAGAAACACGACCAG[G/A]TAAAGTCAGATCAAAAATGTGACACAAACTCAGCCGTAATTACTATTGTCATTCATACAGATTAAATATGCACTTACCAGCTGAAGCATTTACTCAACAGGTTGTGGAGGAGAGGAATAAGCTGCAGGCGAAGCTCCAGGAGGAAGCAGAACTGTACGCAGAGTCTGAGGAGGTCAGGATACGACTGGAGACCAAGAAGCAAGAACTGGAGGAGGTGCTGCATGAGATGGAGGCTCGACTTGAGGAAGAGGAGGAGCGCAGTCAGGCTTTTCAGCAAGAGAAAGGGAATTTGCAACAAAAACTTAAGGTTAAATAGTGATTACTTATGGCAAACTATAGAACAAGTGGAATTTAATGAGACTGTAATTTGTCGAAAACATATCATCAAATTGTTATTTTTATTGTTGAAACTAAAAAAAGACAAACAATAGTAATAATGATGATAAAGCAATAGTAATACTGATACTTATTAGTAGTATAACTTTAATTCTGTAATTGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33244
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004854 Nonsense 1643 1961 33 40
Genomic Location (Zv9):
Chromosome 3 (position 36503603)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 36545501
GRCz11 3 36687359
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTGAAGACCAGGTTGATGTAAACAGCAGAGCGAGGGATGAGGCCGTTAAA[C/T]AACTCCGAAAGATTCAGGTCAGAAAGATAACTCTTCAAATTCTTTCAGAA
Long Flanking Sequence:
AAAACATAACATTTATAAAAGGCCCATGAGCTGGAGAAGACCAAACGTGCACTGGAGGCTCAAGTGGAAGAAATGACAATTCAGATGGAGGAGCTTGAAGATGAATTACAGGCTGCGGAGGATGCTAAGCTCCATTTGGAAGTAAATATGCAGGCCCTCAAAGTCCAAATACAAAGAGACATCCAAGGCAGAGAGGAGCAAAGTGAAGAGAAGAGGAAACAACTCCTCAAGCAGGTGTAGATCAATTTCTTTCTGGGTCTTCTTGAATTTGAACTGCACTTGTAGATTATTTAACTTTATTCATAAAGCAATAGCAAGAAATCTTTTCTTTTATTATTTACTCACTTCATGCACAGGTCCGTGAGCTTGAGGCTGAGCTAGAAGATGAGCAGAAGATGAGAACGTCCTTGGCTGCTGCCAAAAAGAAACTGGAAGGGGATTTGCAGGACCTTGAAGACCAGGTTGATGTAAACAGCAGAGCGAGGGATGAGGCCGTTAAA[C/T]AACTCCGAAAGATTCAGGTCAGAAAGATAACTCTTCAAATTCTTTCAGAATTTCCCAAGCCATTCCCACCAGCCTTTATCTTCCCCATGACAGACTCAGATGAAAGACTACCAGAGGGAGCTGGAAGATGCTCGAGCATCCCACAAGGAAGTTCTTTCCGATGCTAGAGAATCTGAGCGAAAGGCCAGAGCTATGGAGGCCGAAATCTTACACTTGCATGAGGTAACATAATACCACATTTTTTTACTGCAATGTACTTAAATTACTTCCCATACAACGGCAATACCAATCCCTTTATAGGAACTTGCTTCAGCAGAGAAAGCTCGCAAACATGCTGAAAGAGAGAGGGATGAGATAGCAGGGGAGATGGCAAGTGGTTCCTTCGGAAAGTAAGTTGAGGGTTATTATTAGTGAAAGGAGAAAAATAAACAGGACAAGCCACTAAACATACAATTATTGCACACTGATAGATCTGGTACGTCTGATGAGAAACGTCGTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa26113
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004854 Nonsense 1916 1961 39 40
Genomic Location (Zv9):
Chromosome 3 (position 36504891)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 36544213
GRCz11 3 36686071
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AACTTCAGAAAGAGCTGAATGAGGCCATCGAGGCCAACGATGCCCTGAGC[A/T]GAGAAGTTTCCTCACTCAGGAGCAAACTCAGGTTGTTCTGAAGTGACTCC
Long Flanking Sequence:
AGATGGAGGGACAAGTCAAGTCCAAGCAACGGTCCACTGTAGCTGCCCTAGAGTCGAAGTTACAACAAACAGAAGACCAGCTGGATCATGAAAGCAGGTGAGATCATCAGCATTAAGATGGATTTGGTTGTAAAGAAAAAGTAGGCCCGACTAAAATATTTTCTTGCTCTAGAGAGAGACAAGCAATTGCAAAGGCCATGCGCCAGAAAGACAAGAAACTAAAGGAGCTGATGAATCAGGTAGAGGATGAACGGAAACAGATGGAGCAATATAAGGACCAGGTATAAAGGGTTCATGTAAAGTATTTGACGTCCTATGTTCTATTCTGACAAATCTAATGGACGTTGCATATGTTTAAGGCTGAGAAAGCAAATCTTCGAGCAAGGCAGCTGAAGATGCAGATGGAAGAGAGCGATGAAGAATCTCAGCGTGCTACTGCTGCTCGGCGTAAACTTCAGAAAGAGCTGAATGAGGCCATCGAGGCCAACGATGCCCTGAGC[A/T]GAGAAGTTTCCTCACTCAGGAGCAAACTCAGGTTGTTCTGAAGTGACTCCTTTTTATTGTGTATGTGAAACCAGAATTCCACTGACATTCTCTGTATTGTACAAAGATATAAAATCAGTGGAATAGATAATCACTTTTGAAAATCGTGTTTGGAGACAAGTGGATTCTTAGTATCCTTTATGTTCCTCAGGCGTGGCAGTGATTCATCCTTCAGCACACCATTAAGGCGTAGCGCTGGTGGAAGCTTTAGACAAGCACGCAGAACCATGATGGAAACGTCAGAGATCCCAGAAGATGGGGGTCCATCTGCTACATCAGTGTGTCAACCTGGGGAACTTCAGATGGAGTCAATCAGCAACACCCAGGATAACAACTAAGAAAACGGATTTCCTTCTCGCTTCATGTTTTTTCCTATTTCTGTGTAATTTATACTTATTTAATCTTGATCATCTCCTACAAAGGAGGATTGGTACTTATGTTTGTTCTTTATGGGTAAAAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18760
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004854 Essential Splice Site 1926 1961 40 40
Genomic Location (Zv9):
Chromosome 3 (position 36505081)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 36544023
GRCz11 3 36685881
KASP Assay ID:
2259-3809.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAAATCGTGTTTGGAGACAAGTGGATTCTTAGTATCCTTTATGTTCCTCA[G/T]GCGTGGCAGTGATTCATCCTTCAGCACACCATTAAGGCGTAGCGCTGGTG
Long Flanking Sequence:
AAAGGCCATGCGCCAGAAAGACAAGAAACTAAAGGAGCTGATGAATCAGGTAGAGGATGAACGGAAACAGATGGAGCAATATAAGGACCAGGTATAAAGGGTTCATGTAAAGTATTTGACGTCCTATGTTCTATTCTGACAAATCTAATGGACGTTGCATATGTTTAAGGCTGAGAAAGCAAATCTTCGAGCAAGGCAGCTGAAGATGCAGATGGAAGAGAGCGATGAAGAATCTCAGCGTGCTACTGCTGCTCGGCGTAAACTTCAGAAAGAGCTGAATGAGGCCATCGAGGCCAACGATGCCCTGAGCAGAGAAGTTTCCTCACTCAGGAGCAAACTCAGGTTGTTCTGAAGTGACTCCTTTTTATTGTGTATGTGAAACCAGAATTCCACTGACATTCTCTGTATTGTACAAAGATATAAAATCAGTGGAATAGATAATCACTTTTGAAAATCGTGTTTGGAGACAAGTGGATTCTTAGTATCCTTTATGTTCCTCA[G/T]GCGTGGCAGTGATTCATCCTTCAGCACACCATTAAGGCGTAGCGCTGGTGGAAGCTTTAGACAAGCACGCAGAACCATGATGGAAACGTCAGAGATCCCAGAAGATGGGGGTCCATCTGCTACATCAGTGTGTCAACCTGGGGAACTTCAGATGGAGTCAATCAGCAACACCCAGGATAACAACTAAGAAAACGGATTTCCTTCTCGCTTCATGTTTTTTCCTATTTCTGTGTAATTTATACTTATTTAATCTTGATCATCTCCTACAAAGGAGGATTGGTACTTATGTTTGTTCTTTATGGGTAAAAACTGACTAATTAAAAAGGGTGTGTATGCAGGGTTGTACAAGCAAGCAAATTTATTACCGAGTACCATGGTGCCTCCATGCATTTTGGGCATGAACATCATAAAATAATGGTTAATTAACTCTTTAGCACTAATGACCTTATTCTGCAATACGGAAGTGCACTTGTTTTTGCGATTGTTTTAGTATTAAATAT
Associated Phenotype:
Not determined