Busch Lab

ZMP

ell2

Ensembl ID:
ENSDARG00000006251
ZFIN ID:
ZDB-GENE-030131-1717
Description:
elongation factor, RNA polymerase II, 2 [Source:RefSeq peptide;Acc:NP_001077281]
Human Orthologue:
ELL2
Human Description:
elongation factor, RNA polymerase II, 2 [Source:HGNC Symbol;Acc:17064]
Mouse Orthologue:
Ell2
Mouse Description:
elongation factor RNA polymerase II 2 Gene [Source:MGI Symbol;Acc:MGI:2183438]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa23869 Essential Splice Site Available for shipment Available now
sa37248 Nonsense Available for shipment Available now
sa8757 Nonsense Mutation detected in F1 DNA Not yet available
sa23870 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa23869
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102404 Essential Splice Site 60 132 None 10
ENSDART00000102408 Essential Splice Site 60 655 None 12
ENSDART00000130635 Essential Splice Site 80 635 None 15

The following transcripts of ENSDARG00000006251 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 10178315)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 11661678
GRCz11 21 11754306
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAATGCACCGTCCACACAGGCGACGATACGATTTCAGGGTCTTCAAGGGG[T/A]AAGTTCAGTTCATGTTAAATTGTAAAAACTCATCTAATTGCAGTATACAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37248
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102404 Nonsense 79 132 3 10
ENSDART00000102408 Nonsense 79 655 3 12
ENSDART00000130635 Nonsense 99 635 4 15

The following transcripts of ENSDARG00000006251 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 10183092)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 11666455
GRCz11 21 11759083
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAAATTCCAACCACAGAGGCTTCCGATGGCTCTCATAACTTCAACTTTTA[T/G]CTGTCCAACTTTGGCAAAGACAATCCTCAAGGAAGCTTCGAGTGTATCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8757
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102404 None None 132 None 10
ENSDART00000102408 Nonsense 543 655 9 12
ENSDART00000130635 Nonsense 522 635 12 15

The following transcripts of ENSDARG00000006251 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 10193542)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 11676905
GRCz11 21 11769533
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GAGAAGCCTGTCAATAGCACTGAACTTCCAGCCCCAACTAAGCCTGATTA[C/A]ATAAGGTGAGTGAACTTTGACTCCTCTGGAAAGGAAAACTGTTTTTGTTT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa7950
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102404 None None 132 None 10
ENSDART00000102408 Nonsense 547 655 10 12
ENSDART00000130635 Nonsense 526 635 13 15

The following transcripts of ENSDARG00000006251 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 10193660)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 11677023
GRCz11 21 11769651
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AAGTGAGCAAAAGACATATCTTGAGGCNNNTTGTTTTATTGCAGTAAGTA[C/A]ACTGCAGTCATATCAATGGATCAGAGGCAGCACTATAAAGACGACTTCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23870
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102404 None None 132 None 10
ENSDART00000102408 Essential Splice Site 617 655 11 12
ENSDART00000130635 Essential Splice Site 597 635 14 15

The following transcripts of ENSDARG00000006251 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 10196541)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 11679904
GRCz11 21 11772532
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AACAGGAAGTGCATGAACAGGTGCTGCAAGAATATAAAAAAATTAAACAA[G/A]TGAGTGTAACTGAGCACGTCTAACCCATCTGGTCTTTTAAACAAACCTAT
Associated Phenotype:
Not determined