Busch Lab

ZMP

slc27a1

Ensembl ID:
ENSDARG00000006240
ZFIN ID:
ZDB-GENE-050320-112
Description:
solute carrier family 27 (fatty acid transporter), member 1 [Source:RefSeq peptide;Acc:NP_001013555
Human Orthologue:
SLC27A1
Human Description:
solute carrier family 27 (fatty acid transporter), member 1 [Source:HGNC Symbol;Acc:10995]
Mouse Orthologue:
Slc27a1
Mouse Description:
solute carrier family 27 (fatty acid transporter), member 1 Gene [Source:MGI Symbol;Acc:MGI:1347098]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa15160 Nonsense Available for shipment Available now
sa40164 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa40165 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa15160
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018908 Nonsense 145 647 3 13
Genomic Location (Zv9):
Chromosome 3 (position 53196457)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 52303772
GRCz11 3 52558435
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GATGTGGTGGCRCTGTTCATGGAGAGCAGACCCCTTCAGGTGGCACTCTG[G/A]CTGGGCCTGGCCAAAGTCGGTGTGGAAGCTGCACTCATTAACTTCAACCT
Long Flanking Sequence:
TAGTTAGCTGAATCCAACTTGAACCCATTGCAATTTTTTTTGTGGGGAAATCCTTTAGATTTCTGTTGCAATGACTGGATTATGCAGACAATGTTAAATGTTACAACAGCAGCTTCACAGACATTGGCTAAATTTAATCACTCCAAGTGAGACTTGAGATAAAAGATAAACAACTGTTTGAATTAATATCTCAAATGTTTTAATAACCGATTTCTCTTTCTCTCGTCCATTAGTGGTCTTTATGTGCTGCTGAGGGTTAAACTGGCACTATGGCATTATATGCGCAACCGAAACACCATACCCTCCATCTTTGCACAAACTGTGGCTCGGCACCCAGACAAGCCTGCGCTTGTGTATGAAGCCACTGGGGAGACGTGGACTTTCTCCCAGTTAGATCAAATCTCCAATGCTGTGGCCCACTGGGCACTGAGCCAAGGCTGGACCTCAGGAGATGTGGTGGCGCTGTTCATGGAGAGCAGACCCCTTCAGGTGGCACTCTG[G/A]CTGGGCCTGGCCAAAGTCGGTGTGGAAGCTGCACTCATTAACTTCAACCTGCGAAGGGATTCGCTCCTGCACTGCGTGGGTGTTTCAGCTTCCAGGGGAATTGTTTTTGGAGCAGAGCTTGCTGACGGTGAGTAGAAAATGTGCCCTATTTTTCATGGCCAAACCCACTTGCAGATTTTTTACAAGCAAAATGACAGATTTCAAGTTTTTTGTTTCCAAAAACAGAAGTATTTATTATATTATTAAAAACAGAAATGTGTATTTGCTTTATTTTTTTCTGAAATGTCTGCAGTGATTTAAAATTAGAGGCAACCAATGAATTTAATTCAAGATTCACACAAAGGTGCCACATATGTTAGTTCTGGACTGAGTTATACTACTTTGTTGAGTGATCAGCGCATGCCTTGCTGCGTACGCTGTAAAATGTAGTAAGTTGAACTTACTTTATTTGCCTTCATTTCAAAGTAAAGTAGTGTATTAATTTTAAGTGAACATAAGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40164
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018908 Essential Splice Site 243 647 4 13
Genomic Location (Zv9):
Chromosome 3 (position 53201651)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 52308966
GRCz11 3 52563629
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCTGCCCCTCGACACCCACCATCCTGCACTGTGTCCAAGGGCTTCAATGG[T/G]GAGATTCACTCTACCAAGGTTTCCTGTTGAGCTGAGTTGTCGAACACATG
Long Flanking Sequence:
ATATGTTGAGCGTGATTGAAACACTGGCCAATCGGTGGTGTATAAGAATCTACTCAATAGTTCCACAAGTGTTCGTTGAAAATTGATATTTTAATTTCAGCTCTGACTGGTGTCAAATTTTAATACATTTGAGGTCACATCTGTTCCACATCTTCAGCTTCTCTGTCTGGTTTATGGGCTATAGTATACACTTTTTGTAATGCAGTTGGAGGGCAAATTGAAACAAAAAACAAGGAAAAACATCATCCAGACAGATTGATCTGTGCATTTCTCTTTGACAGTTTGCCCACTGGACCATGCAACTAATGGCAAATGCCTTCCTGTGTTTATATAGCTGTGTCTGAAGTGAGCCACTCCTTGAGTCAGACCATGGTGCGGTTCAGCACAGGAGACCTCAAACCAGACCTGATGGCCACTCTCAAGTGTCAGCCTCTTGACCCCATCCTGGCATCTGCCCCTCGACACCCACCATCCTGCACTGTGTCCAAGGGCTTCAATGG[T/G]GAGATTCACTCTACCAAGGTTTCCTGTTGAGCTGAGTTGTCGAACACATGAACCATGAGTTAAATATGGCTTGTGTAGGAGTCCAAGCTGCCCTGCAGGAAGAGTTTTATTTATACTGTTGGCTAGGGTTGTGTGATAAGTATAGTGTGTGATAGAAATGCAGCAAAATGGAAATTTTGGATGAAAAACCTTTAGAATTGGAAGATATTAACTAATATGAAGGTCAATAAATATAAATCTTAATATGAATACTCAAACTTAATAGAGTGGAGGAACTATGACGTCACTTTGTAGGTTAATCGGCTGCTAGCATTAATACAGGTTCCCTCGTGAAAATCCCTATAGGATTTTCCTATAGGGTTTTCGAAGATTGCGAATAATAAGCTCTGTGTTCAAACACTGTTCATTACACTTACACGTTTTGTTCAGCTGGATAATTGTCACACGAAAATACAACTTTGAGCACTTTTGGATCTTAAATGCAAACGCAAGACTTGAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40165
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018908 Nonsense 495 647 11 13
Genomic Location (Zv9):
Chromosome 3 (position 53232688)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 52340003
GRCz11 3 52594666
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACTCACCCTGTAAACTTTTCTTTTATTCTGGTGACTCTTAGGTGATGTTT[T/A]GGTAATGGACGAGCTTGGATACATGTATTTCCGAGACCGAAGCGGAGACA
Long Flanking Sequence:
AATCATAAATAGCTTTAACACACATCTTTCAAAATCAAAGTTGTGCATCTTAAAAACACTCCTTAACCGAATCAAAATGGTATAGCACCTACTATTGGATTGAGAACCACCAGTTAAGAAATGCTGCTCTCGCTATGGCAGCTTCTTTGCAGCAGTGAATAAAGTCTATATACACCATTCATTTTTAAAAACAATTTGTATTTTTTGTATTTTATACAGTTTAAATGGTTAATAAGGCACATATATCATACATGTCACATGCATATTGTCTCAAGAGGGCAGAAAGGATAAAATCAAAAGTGCTAAATTAAAAAAATAAAAAAAATGGTGCAACATACATACTCTTAATTTCACACTTATTTAAATGTACCTTAAGCTAAAGCACCAAAAAAAAAAAAATAAATAAATCAATAAAACATGTCGAAAAAAACTCATTCTGCTATTTTGTGAACTCACCCTGTAAACTTTTCTTTTATTCTGGTGACTCTTAGGTGATGTTT[T/A]GGTAATGGACGAGCTTGGATACATGTATTTCCGAGACCGAAGCGGAGACACGTTTCGTTGGAAAGGAGAGAACGTGTCCACCACTGAAGTAGAGGGAACGCTGAGCGGCCTGTTGAGACAGACTGATGTGGCAGTGTTTGGAGTAAACGTACCAGGTGAAACAATTGAAGTATTAGTCTATAATTCCAAAGTGTAAACCTCTGATTCCTCATAAACCTGCTCATGTGTGTTTGTACAGGTGTGGAGGGAAAAGCGGGAATGGCTGCCATCGCTGACTCGACTGGAAGCTTCAACTGTAATTCTTTCCTAAAAGAGGTTCAGCAAGCTCTTCCTCCATATGCACGGCCAATATTTCTACGCATCTGCCCATGTGTAGATACCACAGGTGAGAAAACGTTGTTCATATTTGTACCATGATTGGGTGATATAATGAGTATAAATGCATCATAGTTATTAAAAATTTCGCTCTCTCACAAATTGTGAATATGAGAGCATTGAGG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa5230
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018908 Nonsense 566 647 12 13
Genomic Location (Zv9):
Chromosome 3 (position 53232985)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 52340300
GRCz11 3 52594963
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GGAAAAGCGGGAATGGCTGCCATCGCTGACTCGACTGGAAGCTTCAACTG[T/A]AAYTCTTTCCTAAAAGAGGTTCAGCAAGCTCTTCCTCCATATGCACGGCC
Long Flanking Sequence:
AAGTGCTAAATTAAAAAAATAAAAAAAATGGTGCAACATACATACTCTTAATTTCACACTTATTTAAATGTACCTTAAGCTAAAGCACCAAAAAAAAAAAAATAAATAAATCAATAAAACATGTCGAAAAAAACTCATTCTGCTATTTTGTGAACTCACCCTGTAAACTTTTCTTTTATTCTGGTGACTCTTAGGTGATGTTTTGGTAATGGACGAGCTTGGATACATGTATTTCCGAGACCGAAGCGGAGACACGTTTCGTTGGAAAGGAGAGAACGTGTCCACCACTGAAGTAGAGGGAACGCTGAGCGGCCTGTTGAGACAGACTGATGTGGCAGTGTTTGGAGTAAACGTACCAGGTGAAACAATTGAAGTATTAGTCTATAATTCCAAAGTGTAAACCTCTGATTCCTCATAAACCTGCTCATGTGTGTTTGTACAGGTGTGGAGGGAAAAGCGGGAATGGCTGCCATCGCTGACTCGACTGGAAGCTTCAACTG[T/A]AATTCTTTCCTAAAAGAGGTTCAGCAAGCTCTTCCTCCATATGCACGGCCAATATTTCTACGCATCTGCCCATGTGTAGATACCACAGGTGAGAAAACGTTGTTCATATTTGTACCATGATTGGGTGATATAATGAGTATAAATGCATCATAGTTATTAAAAATTTCGCTCTCTCACAAATTGTGAATATGAGAGCATTGAGGAGATGATTAATTGCCATCTATAATTTATTTTGGTAATTTTTATGATAATCTAATTTGGTAGTTTAATTTTATAAATTACATGAATCTGTTCAAATAGTCGGTTTTAAAAAGTCAATTTACAACTGATATAGTCATTTGTTTGCTTTAATGCTCAAAAATGATATTATTGATGAGCAAAACATTTTGAATCTTCTTTGCTATGTTGACAGTTTGGCTACAATTATGATTTATCTTTAAAAAATGTATGCTGCAAGCTGATTTCTTTTGGATGCCCAATCACATCACAAAAGAATAATA
Associated Phenotype:
Not determined