Busch Lab

ZMP

ugt1a5

Ensembl ID:
ENSDARG00000006220
ZFIN IDs:
ZDB-GENE-040426-2762, ZDB-GENE-071004-4, ZDB-GENE-071004-5, ZDB-GENE-080227-3, ZDB-GENE-080227-5, ZDB-GENE-080227-5, ZDB-GENE-080227-6, ZDB-GENE-080227-7, ZDB-GENE-080227-7
Description:
UDP glycosyltransferase 1 family, polypeptide A1 precursor [Source:RefSeq peptide;Acc:NP_001032505]
Human Orthologues:
UGT1A1, UGT1A10, UGT1A3, UGT1A4, UGT1A5, UGT1A6, UGT1A7, UGT1A8, UGT1A9
Human Descriptions:
UDP glucuronosyltransferase 1 family, polypeptide A1 [Source:HGNC Symbol;Acc:12530]
UDP glucuronosyltransferase 1 family, polypeptide A10 [Source:HGNC Symbol;Acc:12531]
UDP glucuronosyltransferase 1 family, polypeptide A3 [Source:HGNC Symbol;Acc:12535]
UDP glucuronosyltransferase 1 family, polypeptide A4 [Source:HGNC Symbol;Acc:12536]
UDP glucuronosyltransferase 1 family, polypeptide A5 [Source:HGNC Symbol;Acc:12537]
UDP glucuronosyltransferase 1 family, polypeptide A6 [Source:HGNC Symbol;Acc:12538]
UDP glucuronosyltransferase 1 family, polypeptide A7 [Source:HGNC Symbol;Acc:12539]
UDP glucuronosyltransferase 1 family, polypeptide A8 [Source:HGNC Symbol;Acc:12540]
UDP glucuronosyltransferase 1 family, polypeptide A9 [Source:HGNC Symbol;Acc:12541]
Mouse Orthologues:
Ugt1a1, Ugt1a10, Ugt1a2, Ugt1a5, Ugt1a6a, Ugt1a6b, Ugt1a7c, Ugt1a8, Ugt1a9
Mouse Descriptions:
UDP glucuronosyltransferase 1 family, polypeptide A1 Gene [Source:MGI Symbol;Acc:MGI:98898]
UDP glucuronosyltransferase 1 family, polypeptide A2 Gene [Source:MGI Symbol;Acc:MGI:3576049]
UDP glucuronosyltransferase 1 family, polypeptide A5 Gene [Source:MGI Symbol;Acc:MGI:3032634]
UDP glucuronosyltransferase 1 family, polypeptide A6A Gene [Source:MGI Symbol;Acc:MGI:2137698]
UDP glucuronosyltransferase 1 family, polypeptide A6B Gene [Source:MGI Symbol;Acc:MGI:3580629]
UDP glucuronosyltransferase 1 family, polypeptide A7C Gene [Source:MGI Symbol;Acc:MGI:3032636]
UDP glucuronosyltransferase 1 family, polypeptide A8 Gene [Source:MGI Symbol;Acc:MGI:3576090]
UDP glucuronosyltransferase 1 family, polypeptide A9 Gene [Source:MGI Symbol;Acc:MGI:3576092]
UDP glycosyltransferase 1 family, polypeptide A10 Gene [Source:MGI Symbol;Acc:MGI:3580642]

Alleles

There are 7 alleles of this gene:

Allele Name Consequence Status Availability
sa8443 Nonsense Mutation detected in F1 DNA Not yet available
sa8617 Nonsense Mutation detected in F1 DNA Not yet available
sa18078 Nonsense Available for shipment Available now
sa34568 Nonsense Mutation detected in F1 DNA Not yet available
sa15206 Nonsense Available for shipment Available now
sa27349 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa8443
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010246 None None 525 None 5
ENSDART00000014518 None None 526 None 5
ENSDART00000081463 None None 520 None 5
ENSDART00000102448 None None 342 None 6
ENSDART00000121990 None None 519 None 5
ENSDART00000123415 None None 515 None 5
ENSDART00000124423 None None 520 None 5
ENSDART00000124516 Nonsense 21 520 1 5
ENSDART00000125852 None None 536 None 5
ENSDART00000127780 Nonsense 28 527 1 5
ENSDART00000130243 None None 520 None 5
ENSDART00000010246 None None 525 None 5
ENSDART00000014518 None None 526 None 5
ENSDART00000081463 None None 520 None 5
ENSDART00000102448 None None 342 None 6
ENSDART00000121990 None None 519 None 5
ENSDART00000123415 None None 515 None 5
ENSDART00000124423 None None 520 None 5
ENSDART00000124516 Nonsense 21 520 1 5
ENSDART00000125852 None None 536 None 5
ENSDART00000127780 Nonsense 28 527 1 5
ENSDART00000130243 None None 520 None 5
Genomic Location (Zv9):
Chromosome 9 (position 10228430)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 10032277
GRCz11 9 10003650
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGCMCTAGTTTTGTGTCTTTTCTGCCTAGTATCAGCAGAAGCTGGGAAYT[T/G]ACTRGTAATTCCAGCRCTTGGCAGCCACTGGACTGGCATGAGACCTTTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8617
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010246 None None 525 None 5
ENSDART00000014518 None None 526 None 5
ENSDART00000081463 None None 520 None 5
ENSDART00000102448 None None 342 None 6
ENSDART00000121990 None None 519 None 5
ENSDART00000123415 None None 515 None 5
ENSDART00000124423 None None 520 None 5
ENSDART00000124516 Nonsense 21 520 1 5
ENSDART00000125852 None None 536 None 5
ENSDART00000127780 Nonsense 28 527 1 5
ENSDART00000130243 None None 520 None 5
ENSDART00000010246 None None 525 None 5
ENSDART00000014518 None None 526 None 5
ENSDART00000081463 None None 520 None 5
ENSDART00000102448 None None 342 None 6
ENSDART00000121990 None None 519 None 5
ENSDART00000123415 None None 515 None 5
ENSDART00000124423 None None 520 None 5
ENSDART00000124516 Nonsense 21 520 1 5
ENSDART00000125852 None None 536 None 5
ENSDART00000127780 Nonsense 28 527 1 5
ENSDART00000130243 None None 520 None 5
Genomic Location (Zv9):
Chromosome 9 (position 10228430)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 10032277
GRCz11 9 10003650
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGCMCTAGTTTTGTGTCTTTTCTGCCTAGTATCAGCAGAAGCTGGGAAYT[T/G]ACTRGTAATTCCAGCRCTTGGCAGCCACTGGACTGGCATGAGACCTTTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18078
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010246 None None 525 None 5
ENSDART00000014518 None None 526 None 5
ENSDART00000081463 None None 520 None 5
ENSDART00000102448 None None 342 None 6
ENSDART00000121990 None None 519 None 5
ENSDART00000123415 None None 515 None 5
ENSDART00000124423 Nonsense 94 520 1 5
ENSDART00000124516 None None 520 None 5
ENSDART00000125852 None None 536 None 5
ENSDART00000127780 None None 527 None 5
ENSDART00000130243 None None 520 None 5
Genomic Location (Zv9):
Chromosome 9 (position 10222586)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 10026433
GRCz11 9 9997806
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CAGATAMAGGAGATTGTGMAAGCCGGTGTTACAACTCTGATAAGTACTTA[T/A]GTATCTACAGATCTGSCYAGGTTTCAGAGTTTCATCAACAGAATGAATTY
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34568
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010246 None None 525 None 5
ENSDART00000014518 Nonsense 255 526 1 5
ENSDART00000081463 None None 520 None 5
ENSDART00000102448 None None 342 None 6
ENSDART00000121990 None None 519 None 5
ENSDART00000123415 None None 515 None 5
ENSDART00000124423 None None 520 None 5
ENSDART00000124516 None None 520 None 5
ENSDART00000125852 Nonsense 265 536 1 5
ENSDART00000127780 None None 527 None 5
ENSDART00000130243 None None 520 None 5
Genomic Location (Zv9):
Chromosome 9 (position 10206685)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 10010532
GRCz11 9 9981905
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAAGGACACCTCATACGCAGAGCTGTTAGGTCACGGTGCAGTTTGGCTTT[T/A]AAGGTACGACTTCAGCTTTGAATACCCTAAACCCCAAATGCCAAACATGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15206
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010246 None None 525 None 5
ENSDART00000014518 None None 526 None 5
ENSDART00000081463 None None 520 None 5
ENSDART00000102448 None None 342 None 6
ENSDART00000121990 None None 519 None 5
ENSDART00000123415 None None 515 None 5
ENSDART00000124423 None None 520 None 5
ENSDART00000124516 None None 520 None 5
ENSDART00000125852 None None 536 None 5
ENSDART00000127780 None None 527 None 5
ENSDART00000130243 Nonsense 5 520 1 5
Genomic Location (Zv9):
Chromosome 9 (position 10205470)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 10009317
GRCz11 9 9980690
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTCTTCTCCTGCCACTGTACTTCACATCATTGAYAAATGGCTTGCTTGTG[G/A]TTGCTCGGGAGTCTGCTCCTCCTTGGTTCAGCTGAAGCTGGGAAACTGTT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa5524
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010246 None None 525 None 5
ENSDART00000014518 None None 526 None 5
ENSDART00000081463 None None 520 None 5
ENSDART00000102448 None None 342 None 6
ENSDART00000121990 None None 519 None 5
ENSDART00000123415 None None 515 None 5
ENSDART00000124423 None None 520 None 5
ENSDART00000124516 None None 520 None 5
ENSDART00000125852 None None 536 None 5
ENSDART00000127780 None None 527 None 5
ENSDART00000130243 Nonsense 196 520 1 5
Genomic Location (Zv9):
Chromosome 9 (position 10204899)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 10008746
GRCz11 9 9980119
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GCCCAGCTCCACCATCTTATGTTCCACAAACATTTACTCATTTTACTGAC[C/T]GMATGAATCTCTGGCAAAGAAGTATAAACTTTGTAAGGGCTCTTCTTCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa27349
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010246 Nonsense 16 525 1 5
ENSDART00000014518 None None 526 None 5
ENSDART00000081463 None None 520 None 5
ENSDART00000102448 None None 342 None 6
ENSDART00000121990 None None 519 None 5
ENSDART00000123415 None None 515 None 5
ENSDART00000124423 None None 520 None 5
ENSDART00000124516 None None 520 None 5
ENSDART00000125852 None None 536 None 5
ENSDART00000127780 None None 527 None 5
ENSDART00000130243 None None 520 None 5
Genomic Location (Zv9):
Chromosome 9 (position 10202534)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 10006381
GRCz11 9 9977754
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGGATGAGAACACTGCCTGTTCCTGCTCAGGGGCTTCTCGCCTTGCTGTG[C/A]TTGTTCTCTTTTGAGTCTGTGCAAGCTGGAAAGGTGCTTGTCTTACCAGT
Associated Phenotype:
Not determined