Busch Lab

ZMP

MYT1L (2 of 2)

Ensembl ID:
ENSDARG00000006212
Description:
myelin transcription factor 1-like [Source:HGNC Symbol;Acc:7623]
Human Orthologue:
MYT1L
Human Description:
myelin transcription factor 1-like [Source:HGNC Symbol;Acc:7623]
Mouse Orthologue:
Myt1l
Mouse Description:
myelin transcription factor 1-like Gene [Source:MGI Symbol;Acc:MGI:1100511]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa43015 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa1325 Essential Splice Site Available for shipment Available now
sa36540 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa43015
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047089 Essential Splice Site 49 721 1 29
ENSDART00000047089 Essential Splice Site 49 721 1 29
Genomic Location (Zv9):
Chromosome 17 (position 51997429)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 51383175
GRCz11 17 51472210
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCACCGCAGCCTGTCTGGATGTCCTCATAAAGATAGAGTCCCGCCGGAAA[G/A]TAAGCCCTCGACACCGTCCCCGCAAACACCACATGAGCTGCTGCTGCCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1325
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047089 Essential Splice Site 49 721 1 29
ENSDART00000047089 Essential Splice Site 49 721 1 29
Genomic Location (Zv9):
Chromosome 17 (position 51997429)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 51383175
GRCz11 17 51472210
KASP Assay ID:
554-1239.1 (used for ordering genotyping assays)
KASP Sequence:
CCACCGCAGCCTGTCTGGATGTCCTCATAAAGAYAGAGTCCCRCCRGAAA[G/T]TAAGCCCTCGACACCGTCCCCGCAAACACCACATGAGCTGCTGCTGCCTT
Associated Phenotype:
Normal
Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa36540
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047089 Nonsense 615 721 25 29
Genomic Location (Zv9):
Chromosome 17 (position 52032621)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 51418367
GRCz11 17 51507402
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGATGCAGATATTAAACAGCTGGATGAAGATATTAAGGGTTTAAATGAAT[C/A]AAATTCACAGGTGGAAGCAGATATGATCAAACTCCGAACACAGGTAAGGG
Associated Phenotype:
Not determined