Busch Lab

ZMP

erbb3a

Ensembl ID:
ENSDARG00000006202
ZFIN ID:
ZDB-GENE-030916-3
Description:
erbB-3a [Source:RefSeq peptide;Acc:NP_001005320]
Human Orthologue:
ERBB3
Human Description:
v-erb-b2 erythroblastic leukemia viral oncogene homolog 3 (avian) [Source:HGNC Symbol;Acc:3431]
Mouse Orthologue:
Erbb3
Mouse Description:
v-erb-b2 erythroblastic leukemia viral oncogene homolog 3 (avian) Gene [Source:MGI Symbol;Acc:MGI:95

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa7024 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26673
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014892 Nonsense 62 1305 1 26
Genomic Location (Zv9):
Chromosome 6 (position 7407152)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 7333168
GRCz11 6 7490337
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGGAAATGTACACAGGTTGCCAGATTGTCATAGGAAACCTGGAGATCACA[C/T]AGATGGAGCACAACCGCGATTTCTCATTCCTACAGGTGGGGAAAATAGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7024
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014892 Nonsense 118 1305 2 26
Genomic Location (Zv9):
Chromosome 6 (position 7407954)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 7333970
GRCz11 6 7491139
KASP Assay ID:
554-5458.1 (used for ordering genotyping assays)
KASP Sequence:
GGAACGTCTCTGTATGAAGATAAATTCGCCCTCGCTGTCCTTGTCAACTA[T/A]CAGAAAGACGGAGTGTATGGACTGAGGGAGCTGGGCCTCACACACTTGAC
Associated Phenotype:
Not determined