Busch Lab

ZMP

LRRK2

Ensembl ID:
ENSDARG00000006169
Description:
leucine-rich repeat kinase 2 [Source:HGNC Symbol;Acc:18618]
Human Orthologue:
LRRK2
Human Description:
leucine-rich repeat kinase 2 [Source:HGNC Symbol;Acc:18618]
Mouse Orthologue:
Lrrk2
Mouse Description:
leucine-rich repeat kinase 2 Gene [Source:MGI Symbol;Acc:MGI:1913975]

Alleles

There are 9 alleles of this gene:

Allele Name Consequence Status Availability
sa6814 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa30308 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa38142 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa8399 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa5114 Essential Splice Site F2 line generated Not yet available
sa6813 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3318
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027174 Nonsense 90 2538 4 57
Genomic Location (Zv9):
Chromosome 25 (position 36750568)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 35158184
GRCz11 25 35663123
KASP Assay ID:
554-5575.1 (used for ordering genotyping assays)
KASP Sequence:
TGCTCATCCTAGGTTGGCTGGTCTCTGCTGTGTCGGCTGATGGAAATCTG[T/A]CCCAACACTCTGGATAATCTGGCCAGACCGGTGGACTATGAATTTATAGA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4314
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027174 Nonsense 190 2538 7 57
Genomic Location (Zv9):
Chromosome 25 (position 36748244)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 35155860
GRCz11 25 35660799
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TARTGTCAGTTCTGCCCATTTGACCTGTGTGATTTNGTTAGTTTCTGAGTA[T/A]CACCTGGCGGAGTTCATCGAGAAGAAGGACCATGAGGTGGTTTTGAACGC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa30309
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027174 Essential Splice Site 340 2538 10 57
Genomic Location (Zv9):
Chromosome 25 (position 36745909)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 35153525
GRCz11 25 35658464
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACTGGATGAAGAGTGGAATGAGGAGGACGAGGAGGAACAGAAAGTTCTGG[T/C]AAAGAAAGAAGCCGCTCAGGCGGAGGAGATGCTAATCTGGAGAGAAGCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6814
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027174 Essential Splice Site 390 2538 12 57
Genomic Location (Zv9):
Chromosome 25 (position 36745641)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 35153257
GRCz11 25 35658196
KASP Assay ID:
554-4860.1 (used for ordering genotyping assays)
KASP Sequence:
GTTTGCTTCTCCATTGCAACACAWCCAACMATGYGGAACTGGAAGGAAGG[T/G]TAGCGTTCCTTAATGTYRTGCGCTACATTACAGATTTGCATTCAGGAACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30308
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027174 Essential Splice Site 971 2538 28 57
Genomic Location (Zv9):
Chromosome 25 (position 36728695)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 35136311
GRCz11 25 35641250
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTTTTTTATACATGAACACCCCTTCAAATAAAGCGTTGTCATTTTTTTT[A/C]TCTGATGTCCTCAGGTCAGGGTTTCTCTGAGAGTTTCTCCAGTCCTGTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38142
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027174 Essential Splice Site 1260 2538 33 57
Genomic Location (Zv9):
Chromosome 25 (position 36724826)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 35132442
GRCz11 25 35637381
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGTGGGCCCGACTGGAGAAACTGCACTTAAGCTTCAACAGACTCACTGAG[G/A]TACTGTATGATTCGGCTCTGCACTGATGTCCGGGCCGTTCTCTGACTGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8399
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027174 Essential Splice Site 1768 2538 42 57
Genomic Location (Zv9):
Chromosome 25 (position 36714205)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 35121821
GRCz11 25 35626760
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGAAAACCCAGCTAGTTTCATCAAGATCACCGTTCCATGCTCTCGCAAAG[G/A]TAAAAGANNAACTTSTWTTGCAGTGTTTGGACYNNCTTAAACACTTTGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5114
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027174 Essential Splice Site 1882 2538 45 57
Genomic Location (Zv9):
Chromosome 25 (position 36711224)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 35118840
GRCz11 25 35623779
KASP Assay ID:
554-3533.1 (used for ordering genotyping assays)
KASP Sequence:
TGACAAGCATGAAGGCAATGTGGATCGAAAGTAACNNTGTGTTTTTATAC[T/C]GAAGGGGATGGAGGTTTTGGCTCGGTTTATAAAGCTKTSTACAAGAATGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6813
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027174 Nonsense 2153 2538 50 57
Genomic Location (Zv9):
Chromosome 25 (position 36707958)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 35115574
GRCz11 25 35620513
KASP Assay ID:
554-5366.1 (used for ordering genotyping assays)
KASP Sequence:
CAGAGATGTTGTGTCTGAYGCGAGAGCTGAATGTTGTGGGTTTTCCAGGC[G/T]AGTGTTTTGTCGTGTCCAATTCAGGCGGAGCTGCAAACGGAGGTAAAAAC
Associated Phenotype:
Not determined