Busch Lab

ZMP

pde11al

Ensembl ID:
ENSDARG00000006151
ZFIN ID:
ZDB-GENE-031118-106
Human Orthologue:
PDE11A
Human Description:
phosphodiesterase 11A [Source:HGNC Symbol;Acc:8773]
Mouse Orthologue:
Pde11a
Mouse Description:
phosphodiesterase 11A Gene [Source:MGI Symbol;Acc:MGI:3036251]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa42705 Nonsense Mutation detected in F1 DNA Not yet available
sa11083 Nonsense Available for shipment Available now
sa5892 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa32085 Nonsense Available for shipment Available now
sa11067 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa42705
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006412 Nonsense 121 927 1 20
ENSDART00000133403 None None 449 None 14

The following transcripts of ENSDARG00000006151 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 23269847)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 21379598
GRCz11 16 21185417
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTCCCAGTCGAGCATGCGGCGGCGCGCGCTCCTGCGGAAAGCCAGTTCGT[T/A]ACCGCCGACCACCGCGCACATCTTGAGCGCGCTGCTCGAGTCCCGAGTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11083
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006412 Nonsense 142 927 1 20
ENSDART00000133403 None None 449 None 14

The following transcripts of ENSDARG00000006151 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 23269783)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 21379534
GRCz11 16 21185353
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GCGCACATCTTGAGCGCGCTGCTCGAGTCCCGAGTGAACGTGCCTCAATA[T/A]GCCTCCAGCGCCATTGACTACAAATACCGACTYAAAGAGTCCAACGAAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5892
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006412 Essential Splice Site 600 927 11 20
ENSDART00000133403 None None 449 None 14

The following transcripts of ENSDARG00000006151 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 23246861)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 21356612
GRCz11 16 21162431
KASP Assay ID:
554-3833.1 (used for ordering genotyping assays)
KASP Sequence:
GGATGTTTTTRGAGCTTGGTGTYGTACAGAAATTCAAAATTGATTATGAG[G/A]TAAGGCAATCACCACATAAATGGAGGCCAAAATCCAACTCTGCTGACTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32085
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006412 Nonsense 689 927 14 20
ENSDART00000133403 None None 449 None 14

The following transcripts of ENSDARG00000006151 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 23240631)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 21350382
GRCz11 16 21156201
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAAGGTCTGGCTCAGCACTGGCACTGCTGTATGGAACATCTGCCACACTT[G/T]AGCATCATCATTTCAACCACGCTGTCATGATCCTGCAGAGTGAGGTGAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11067
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006412 Essential Splice Site 813 927 None 20
ENSDART00000133403 Essential Splice Site 342 449 None 14

The following transcripts of ENSDARG00000006151 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 23229843)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 21339594
GRCz11 16 21145413
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTTTGAACAAGGTGACAGGGAGAGATCGGAGCTGAAGCTGACACCAGCTG[T/A]RTGTAATCTTTCATCATCARAAAATTATGATTATTAAACTTTGCTTTGTC
Associated Phenotype:
Not determined