Busch Lab

ZMP

si:ch211-227c6.4

Ensembl ID:
ENSDARG00000006128
ZFIN ID:
ZDB-GENE-090312-109
Description:
Novel protein similar to vertebrate centrosomal protein 170kDa (CEP170) [Source:UniProtKB/TrEMBL;Acc
Human Orthologue:
CEP170
Human Description:
centrosomal protein 170kDa [Source:HGNC Symbol;Acc:28920]
Mouse Orthologue:
Cep170
Mouse Description:
centrosomal protein 170 Gene [Source:MGI Symbol;Acc:MGI:1918348]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa22243 Essential Splice Site Available for shipment Available now
sa22242 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa2728
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040704 Essential Splice Site 111 548 5 9
ENSDART00000108709 Essential Splice Site 111 388 5 13
ENSDART00000135989 None None 697 None 8
Genomic Location (Zv9):
Chromosome 13 (position 10601985)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 10904314
GRCz11 13 11036789
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GTTCTSTGTRGTGCGAGGAGAGCTGCACGTGCCAGAAGAGGCTCTGAAGG[T/G]AAAACAAGCACTACATCTCACAAGCAGTTTATATGGTNAAAGAATAGTTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22243
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040704 Essential Splice Site 168 548 6 9
ENSDART00000108709 Essential Splice Site 168 388 6 13
ENSDART00000135989 None None 697 None 8
Genomic Location (Zv9):
Chromosome 13 (position 10600444)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 10902773
GRCz11 13 11035248
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGCAGCAGTCAAACCTGCGGAGCCTAACAAAGGAGACGACAAGATGCCAG[G/A]TAAAGAAACCGTATGATGATGTCAGGGTGTAAGATAATTATATTAATGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22242
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040704 None None 548 None 9
ENSDART00000108709 Nonsense 348 388 12 13
ENSDART00000135989 Nonsense 661 697 8 8
Genomic Location (Zv9):
Chromosome 13 (position 10549337)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 10851666
GRCz11 13 10984141
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCCCTGGATCTCAGAGCGGATGGGCACCTCTGCCCAGTAACGGAACCCCA[C/T]AACCACCACCACCAACAACCATAACCAACCCTAGCCCAGAAAAACCCAGT
Associated Phenotype:
Not determined