Busch Lab

ZMP

tbx2b

Ensembl ID:
ENSDARG00000006120
ZFIN ID:
ZDB-GENE-990726-27
Description:
T-box transcription factor TBX2b [Source:UniProtKB/Swiss-Prot;Acc:Q7ZTU9]
Human Orthologue:
TBX2
Human Description:
T-box 2 [Source:HGNC Symbol;Acc:11597]
Mouse Orthologue:
Tbx2
Mouse Description:
T-box 2 Gene [Source:MGI Symbol;Acc:MGI:98494]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability

Mutation Details

This allele has been removed from public view.

Allele Name:
sa7761
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005491 Nonsense 129 671 2 8
ENSDART00000122101 Nonsense 139 687 2 7
Genomic Location (Zv9):
Chromosome 15 (position 26714926)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 27433162
GRCz11 15 27366038
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GAATGTTWCCACCTTTTAAGGTCCGCATTAATGGAYTCGATAAAAAAGCC[A/T]AGTATATTCTTTTAATGGACATTGTGGCTGCCGACGACTGCCGCTACAAG
Associated Phenotype:
Not determined