Busch Lab

ZMP

zgc:63504

Ensembl ID:
ENSDARG00000006112
ZFIN ID:
ZDB-GENE-040426-1138
Description:
Zgc:63504 protein [Source:UniProtKB/TrEMBL;Acc:Q6P405]
Human Orthologue:
MYOF
Human Description:
myoferlin [Source:HGNC Symbol;Acc:3656]
Mouse Orthologue:
Myof
Mouse Description:
myoferlin Gene [Source:MGI Symbol;Acc:MGI:1919192]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa27901 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa8428 Nonsense Mutation detected in F1 DNA Not yet available
sa18158 Essential Splice Site Available for shipment Available now
sa35223 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa27901
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047769 Essential Splice Site 48 1557 2 42
ENSDART00000144283 Essential Splice Site 48 2030 2 53
Genomic Location (Zv9):
Chromosome 12 (position 11645873)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 10528944
GRCz11 12 10566787
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAAGAAAACAAGGTCGATTAACAATGAAGTGAATCCGGTGTGGAATGAGG[T/C]CTGTTGAGATATTCAAGTTTAAATCTTTAATGATTTTGCAAATGAGCTAA
Long Flanking Sequence:
TTTGGAAGAGCATGAAGTAAATGTACTTGATAAAATATTAAATTAAGATTCAAAAGAATTCCATCGTTTAAAAGAAATTGTATGAGCATCACTTCCGCAAAATTCGAGTCCACAGGTAGGCAGTCTGCCACAGTGTCAGAGAAGTCCACACCCTTCACAAACTCTATCCTAAAGGATGAGGGCGATGCAATGAACGCACAGTCTCACATACAGAGACACATCACCATGAAAGAGCACTAATAAGCGAAAGCCTTTTAATCTGTCATGTTGCGCGTGGCAGTTGAATCTGCGGCGGATCTGCCTAAGAAGAAACTGGGCAGTCCAGACCCCATCGCGTCTTTGGTGTTTAGAGGTAAGTGCTCCTCATGTGTTTCACATTTAACCATTAACCAGCAAAATAACGGCACCTAATGTTCGTTTTGTTTGATTTTATATTATTTAAGACGAAAAGAAGAAAACAAGGTCGATTAACAATGAAGTGAATCCGGTGTGGAATGAGG[T/C]CTGTTGAGATATTCAAGTTTAAATCTTTAATGATTTTGCAAATGAGCTAACATGGGCCTATATAAACTGCCAATGTTGTAAATAAGTTATTATTTACTTTAACGCATGACTAACTGCACATTATCATTACTTCAGATGCTGTTTTGCTTTGTGTTACATACTGTTTTGTTTTCACCTTAGACGCTTCAGTTTGATTTAAAAGGTGTTCCTCTTGATTCTTCCTCCTACATTGATGTGATTGTGAAAGACTACGAGACTCTCGGCAAGGACAAGTAAGTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCCTTCTAAATGAGTCATACACTCATTAAATTAACCAATGTAAGACAAACATTGTGATGTTGAACTTTTGCTCCCACCCTGATCAAATACAAGTTGTGTGACTGGAGAAGTTTAAATAGTGTATAAGAGTTTTGAGTTCTTGGAATGTAATGGACATTTCCATTTCTTAAA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27900
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047769 Nonsense 257 1557 9 42
ENSDART00000144283 Nonsense 257 2030 9 53
Genomic Location (Zv9):
Chromosome 12 (position 11631976)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 10515047
GRCz11 12 10552890
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCAAGTAATGCACAGTTGATTTGTGATGTTTTTTCTTTTCTACAGGTCTA[T/A]AACGCTTCTTCTTTTAGAGCTGACTGTCTCATGGGTGAATTCAAGGTATT
Long Flanking Sequence:
GGTCAAAGTGCATGTCTGTGGAGAAACACACAGGACAAGGATCAGGAAGGGGAATAACCCTTACTTTGATGAGGTATGCAATTAATGTTTTGTTGTTGTTGTTTTTTTATTCATTTTTTATTTAAATAACCACTTTTAAAACAATTTTTTAAGTTACTTAATAACTAAGTTGGCTACTTGTTTCTTTATATCTTTGGTTCAGTTTCATACAATAGTTCATGTAAAATCTTCATGGACAAAGATTATGTGCAAATACTTAATTATATATAATTGAGTTAAAATATAATAATATATATTTATATATGACTCTCTACAGATATTCTTTTTTAACATCAACATGTTGCCATCTGAACTGTTTGATGAAGTTATAAGCTTTCGGGTAAGAAAAAAACGATTGGTCACATTTTCTTTTGTGTTCATAATAAGATATATATTTAATAAAAACAGTGATCAAGTAATGCACAGTTGATTTGTGATGTTTTTTCTTTTCTACAGGTCTA[T/A]AACGCTTCTTCTTTTAGAGCTGACTGTCTCATGGGTGAATTCAAGGTATTTCTGTGAATTATTATACTCCTTTTCACCCCCTAAATTATTCTCACACTCTAATTACTGACTTATGAGGTTCTTTTTCTTCTATTTGTAGCTTGATATTGGCTACATTTATGATGAACAAGGTACTCTTCTGACTATCACAAAAGACTCATCATATGTTTACCTGTAGTTGAAAAGATCTTTTGAAGTTTTTTTTTTTTTTTTTCTACCTCAGCTCACTGTATCATGAAGAAATGGATTCTCTTGAATGACCCTGACGACTCAAGCTCAGGAGCAAAGGGTTATCTCAAAGTTAGCATGTTTGTGGTGGGAACTGGAGATGAACCGCCGGTACGTCCACTGAGTGTACATTAGTGTTTTTGCACTGTGTATTGATGAAGTACAATTTTTAATGTTTATTCACACTATGAAATAAAATGAAGTTAAAAAACTGTGAAAACAACTAAACCAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8428
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047769 Nonsense 503 1557 17 42
ENSDART00000144283 Nonsense 503 2030 17 53
Genomic Location (Zv9):
Chromosome 12 (position 11623635)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 10506706
GRCz11 12 10544549
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CAGCCTGAGGGAGTTCTCAGGTTTACCTGACCCATATGATGACCTTAATT[T/A]AGGCAAGGTAAGTGAAGTAAWRCATTTTAAGTCTCTCTTCCARAGTTYAA
Long Flanking Sequence:
GTAAAAAAAATGATGTGTATTAAAAAAATTACATTGTGAAGTGTTTCTACAATTTAACCTTTTCTACTGTATTACTTATCAAGTAAATGCAGCATTGGTAAACATTAGAGACTTAAAAAAACTTAATTCAAACCTTTGTAAAAATGTTTTTGCAGCAAAAGAATCAGTTATATGTAATCATATTGTGATGACGCCCATCAGCAACCTTGTTCATATAGTTGAAATCACAGCATGACTTTAATGATCAAACATTTTAAATTTGTGCTATACTAACCAAACTACTAACATAAAGGTATCCAGGATGCTTTAACTACTATCACACTTAAGGTGATCTAACAAATTTAATGTCACTGGGAGCAGTTTATTGATCATGTTTTCCACAGGAGACACTGGAGAATCTGAGATGGGCTTCCTGCCTACCTTTGGGCCGTGCTATATAAATCTTTATGGCAGCCTGAGGGAGTTCTCAGGTTTACCTGACCCATATGATGACCTTAATT[T/A]AGGCAAGGTAAGTGAAGTAATGCATTTTAAGTCTCTCTTCCAGAGTTCAATTCACTAAAAAAGTCTCTGGGGGTGATCAGTAAAAATCTCAATAATGTTCAATTCAATATTGAAAAATCATTTCAAATCGGCTAAAAAATGTGTGATCATTTGTAGGGTGAAGGAGCAGCTTACCGAGGGAGAATTCTTGTTGAACTCTCTACAAAACTTGATGGAAAGGCTGACAAATCTGTGGAAGAAATATCAAGCGATGATATCTTAGTAGTTCAAGTGAAGCTCTTTGTCTTTTTATTGCTTTCAATGCTCCCTTTTTCTACTTGAAACATTTATTCACAGTTTTCTGTTTTTTTTTTTTCTTTTCTATTTTAAATTTAGAAATACCAGCGCAGGAGGAAGTATTGTCTGTGCGCAGTGTTTCACAGTGCAACTATGATCCAAGAACCCGGCGAGCCCATTCAGTTTGAAGTTAGCATCGGCAACTATGGCAACAAGATGGACCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18158
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047769 Essential Splice Site 1129 1557 31 42
ENSDART00000144283 Essential Splice Site 1129 2030 31 53
Genomic Location (Zv9):
Chromosome 12 (position 11614502)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 10497573
GRCz11 12 10535416
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGTTTACCAGGCCAGAAACCTTACTGCYYTAGACCAAGAYAGTTTTTCAG[G/A]TGTTCTAGCAGTTTTCCTTTGTTTATAATAAMTGTGACAAGGCTTCTATT
Long Flanking Sequence:
AGGAAATGCAGAGGGATGGGAATACTCTTCACTCATCGGCTGGAAGTTCCACAGACAGCAACGATCATCTGACACTTTCCGTCGGCGCCGCTGGAGAAGGAAAATGGCACCCGCTGGTCGTGTTGGAGCCTCTGCCATTTTCAAGCTAGAGGGTGCCCTGGTCAGCACTAGAACTATATCATTATCCTAATACCTATCTGACACTTTAATTTCCACATGAGATGAGTTTGATTATCTACTTTACAGGGAGTCGACATGGAAAGTGAAGAAAAAGGGACCAAAGCAGATTCATCTGTTAAGCAGTTTGGAGCCAACACACCAATGATTTCATGTACATTTGACCGTGAGTTTCAATATATTTTTTTAAAATTACTATTTAAAAAGGTTTCATTTTATTAATATTGAACCTGGTCTCCTTGCAGGATCCAACGCGTACCATTTGCGAGTCTATGTTTACCAGGCCAGAAACCTTACTGCCCTAGACCAAGACAGTTTTTCAG[G/A]TGTTCTAGCAGTTTTCCTTTGTTTATAATAAATGTGACAAGGCTTCTATTATATCTGAAACTGCATTGGTTTAAATTCCAGATCCATACGTCCATGTGTCCTTCTTGCATCACAGCCAAACAACAGAGACGATCCAAAGCAACTTGAACCCAACATGGGATCAAACTCTTATTTTTAAAAATGTGGAAATCTATGGTGATCCCCAATCTCTGGTTCAGAATTCACCAGTAGTGGTTATGGAAATCTTTGACCGTGATCAAGTGGTTAGTCTGACGGATTTATGCTCTCGCTTTCATTACACCCATTTGTCATCAGCTTCTGAATCTGCACCAGGACATTTAAAAGGGAAAAATTAAGAATTTAATTAAATGAATTTAAAAATAAGTAAAATACCAGACAAATTATCGCTACTGTATGTACTTCCCTTTTTAGTATGCAAGTGTATATACAGAATGATTGAATTTTTTATTTATGCTTTTGTGTAGGGTAAAGATGAAATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35223
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047769 Nonsense 1439 1557 39 42
ENSDART00000144283 Nonsense 1439 2030 39 53
Genomic Location (Zv9):
Chromosome 12 (position 11606852)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 10489923
GRCz11 12 10527766
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGGAGTAAGTTTTATGCTTCCCTTGGACAAAGTGAGAAATGCCGTCCATA[T/A]CTTGACAAAGGATATGACACACTGGAGGTGAGTGTCTATACTGTAGCAGA
Long Flanking Sequence:
GATTTAGCCAGCTTCACCCATTTTAACTAACTTTGTGTATTTTGAGTGATATGGGCATGTAATCATGAAGTATATGGACAGGGTGCACAGTTCCATTTAGATTTAGCTGTTGAAATACTGGTATGAATTTCAGAATTCTTTTAAATAGATTTGATAGAAATAACATGTCATTAAACCACCTAGATGTTGCACTGATAAAATTATATAATCCCAACTTTAGTTTAGCAATAATTCTGCTTACCAAACCTTAACATATAATCTTTTTTTTTTTTGTGTGTGTGTGTTCAATACATGGTCTACCTGGCAGCGTGAGAAGGTGAGTTCTTTCTGAGTTCTTTCCACCTAAACCAGTTAGATCTTGATTTACATTATCAACAAATATGTATATTAGTTCATATAGATAACTTGCTAATTTTGTCCAACTTACAGGAGAAAGAGACTGTTGATTGGTGGAGTAAGTTTTATGCTTCCCTTGGACAAAGTGAGAAATGCCGTCCATA[T/A]CTTGACAAAGGATATGACACACTGGAGGTGAGTGTCTATACTGTAGCAGAGCAATATAGATTTGCATTATTATGTAAAATTAAGTCAGTAAATACACTGATATTTAGGAATGCTAAACTCTTAAAGGTGCAGTAGGTGATTGTCTTCAGAAGCATTTTTTGTTGTGCTGGTTGAAAGTCTCTTCACAGTCTAATAATAGGGATTAAAATAAATGATCTAATTGTATTTTTTTGTATTTTTTTTTATTTTAAAACTAAAAAATGTTCATCCAATTAAATAGAGTCGGACCGATATCTCTCATAATTCCGATGAGTAGGCGAAACTCTCTGTCACCAAATGCAGATTTGAACAACTGCGCAGGCGTTTGTACGTAGCTCCGCCGACCGCTGTTGGTGCTGTGCGTTCACGAGAGAGGGTGCGCGCGCAAGATCGGTAAAAACATGCTGTATCAAAACTTTTTAAAAACCTGAATCAATATTGGAGTTACCTTTGCACGCTGG
Associated Phenotype:
Not determined