Busch Lab

ZMP

akap1b

Ensembl ID:
ENSDARG00000006062
ZFIN ID:
ZDB-GENE-030131-6844
Description:
A kinase anchor protein 1, mitochondrial [Source:RefSeq peptide;Acc:NP_001091649]
Human Orthologue:
AKAP1
Human Description:
A kinase (PRKA) anchor protein 1 [Source:HGNC Symbol;Acc:367]
Mouse Orthologue:
Akap1
Mouse Description:
A kinase (PRKA) anchor protein 1 Gene [Source:MGI Symbol;Acc:MGI:104729]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa32042 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa2831
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025713 None None 837 None 10
ENSDART00000112511 Essential Splice Site None 760 1 12
ENSDART00000138988 Essential Splice Site None 837 1 11

The following transcripts of ENSDARG00000006062 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 15 (position 30154748)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 30976455
GRCz11 15 30857196
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ACGTTACATTTAACATTATACGGTGGCGGTGYGAGGGACGCATAAACACA[G/T]TGAGTATGACCCGTGTGCGCGCGTTTTACCTCATGTGTAGATAGGTGAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32042
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025713 Nonsense 828 837 10 10
ENSDART00000112511 Nonsense 751 760 12 12
ENSDART00000138988 Nonsense 828 837 11 11

The following transcripts of ENSDARG00000006062 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 15 (position 30138367)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 30960074
GRCz11 15 30840815
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTCCATTCCTTCTTTTGCAGCTGGTCCTGCTCAATCGCACTTTGGCAGAG[C/T]GAGGTTTCGGCACCTGGGTGGACAGTTTCTGATCCTCCAGAGCTCCTCGC
Associated Phenotype:
Not determined