Busch Lab

ZMP

ust

Ensembl ID:
ENSDARG00000006044
ZFIN ID:
ZDB-GENE-041001-163
Description:
uronyl 2-sulfotransferase [Source:RefSeq peptide;Acc:NP_001027901]
Human Orthologue:
UST
Human Description:
uronyl-2-sulfotransferase [Source:HGNC Symbol;Acc:17223]
Mouse Orthologue:
Ust
Mouse Description:
uronyl-2-sulfotransferase Gene [Source:MGI Symbol;Acc:MGI:2442406]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa13830 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa13830
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007735 Essential Splice Site 220 407 5 8
ENSDART00000133808 Essential Splice Site 145 332 4 7
Genomic Location (Zv9):
Chromosome 20 (position 31352476)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 31423689
GRCz11 20 31326568
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AAATCACCTGATCCGCACACCCCAGATGAAGGATGATGAGAGATATCTGG[T/C]CAGAAGCAYTTTCTGAAWCCCTTCCTTGCTTCCTCATTTTTTNNNNNNNN
Long Flanking Sequence:
TTAAATTATTGATGCTCTTATTTAGGAACTTTTTACACCTATTGCTATTTTTAATTTATTCTTGCAACTATTCTTGCTGCAGTTGTCAGTATCATTGAGTGAAGATACTATACTAAACATTTTCATCTGTTAATTTTTGTTGATTTTTTTTTTTCAGGTGGATTTGATCACAAACATTAGCAATATCCCGCAACCTTTTCTGTACACCAGACATGTTCACTTTCTCAATTTCACCAGGTAAGCAAATCAAGGATCATTTATGTAAATGTTTCTTATCAGATTAAAGATAAAAACACAGGCACACAGACTCTTTATGATATCTTTTTTTTTTTACTTTTTTCTCAGGTTCAGGATAGAACAGCCTGTCTACATAAACATCATCAGGGATCCCATTAACCGTTTTCTCTCGAATTACTTTTTCCGTCGTTTCGGGGACTGGAGAGGAGAGCAAAATCACCTGATCCGCACACCCCAGATGAAGGATGATGAGAGATATCTGG[T/C]CAGAAGCACTTTCTGAATCCCTTCCTTGCTTCCTCATTTTTTAATGACATTCTCTCTTTATTATTTTGTGACATTTTAGTAATTAGGTAGTTCTTTACCTTCAAACTTTTTGTTGTTGTAGTCTCTCACTTGTACTGTAACTTTCAGCATGACATCCATTTCTCCTTTTATATAAATATATTAAAAGTGTATTTTTGTCAAGGATACAGAATGTCAGTAAAAATGAAATGAAGTATGAGACATTTGACAGATTTGATTTAGTTAATTATCCGATTTAGTTACATATCAAATTGATGTAATATTTAAATGAACAATATCTTGTGTAAAATTCTAATCGTGAAAAGAATGTTAATATTGTCCATTTATATTTACAATACATATAATTCAGACCTAGGGGGCGACATGGTGGCTCAGTGGTTAGCACTATCGCCTCACAGCAAGATGGTCACTGGTTCGAGTCCCAGCTGGGTCTGCTGGCATTTCTGTGTGGAGTTTGCATG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4914
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007735 Essential Splice Site 253 407 6 8
ENSDART00000133808 Essential Splice Site 178 332 5 7
Genomic Location (Zv9):
Chromosome 20 (position 31339293)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 31410506
GRCz11 20 31313385
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GCCTCTTCTACATCGTTCCATACTTTTGTGGACAACACCCTCAGTGCAGG[T/C]AATGCAATCTAAAAGCAAACTCTTCTTGTAGTGACAGTCRCAGAACCCGA
Long Flanking Sequence:
TTCTGCATTTCAAACTTTATAAATCCACCTCCAAAGGCCACTTTGAAGTCAGCACAGGTGCTTCAAACCAGAGATTTTAAAGGGAGCAAGTGATGGATGCTGTTCGTTTATTTGAAAGAATCTTTGCAGCTTTATGGTCCCCATCATGTTTCGCTTTTTCAAAGCTCACACTGTAAAGTGAATCCTTCATAGGGTATGGGAATGAGCCCTTCAGAATGGAACGCAGCTTTTAACTTTGCTTATGTGAGTGGCGCCCCCTTGTGTTCTTTCAAACAGTTCGGCGGTACTTTGGATGCATCTGCTAATCTATGATTTATAAGCACTTTTTCTTCTTTTTTTATGCTTTGCGTAGTTTTTGGCTGTATCTCTGTCTGACTCATTTTCCCATTTCTTCACTGCAGGACATTAACGTGTGTATCATGGAGAACTACCCAGAGTGCTCAAACCCTCGCCTCTTCTACATCGTTCCATACTTTTGTGGACAACACCCTCAGTGCAGG[T/C]AATGCAATCTAAAAGCAAACTCTTCTTGTAGTGACAGTCACAGAACCCGAGGAACTCGGATTTGTATAGTGTTATAATAAAGTGTTCAGTGACTGCAGTATAAACATTATATGTGCTGTTTATTTTCACAAACAGTATTATCAGTATTATTATTGCATGCTTTATCAAAAAAATGTTTATTATATTTGTCTGCTACAGGGAGCCGGGTATGTGGGCAGTGGAGAGGGCCAAACAAAATGTTATAGAGAACTTTCTACTTGTGGGGATTCTGGAGGAGCTGGAGGATGTATTACTCTTGCTGGAGAGACTTCTACCTCACTACTTTAGTGATGTCCTAACCATCTACAAGAGTCCAGGTGTGCTTTATTCAGTTACTCTGAATTAAAATGTGAGAAATTCAAATAATAAAGGTAAATGTGAAGGGTAAATTAAATAACATAGAAGTGGAAATAAACAAACATTTATTTGATAATTTTAAAAAATGATGCCCTGATTTACTT
Associated Phenotype:
Not determined