Busch Lab

ZMP

atad5b

Ensembl ID:
ENSDARG00000005974
ZFIN ID:
ZDB-GENE-030131-338
Description:
ATPase family, AAA domain containing 5b [Source:RefSeq peptide;Acc:NP_001076298]
Human Orthologue:
ATAD5
Human Description:
ATPase family, AAA domain containing 5 [Source:HGNC Symbol;Acc:25752]
Mouse Orthologue:
Atad5
Mouse Description:
ATPase family, AAA domain containing 5 Gene [Source:MGI Symbol;Acc:MGI:2442925]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa17344 Nonsense Available for shipment Available now
sa40667 Nonsense Mutation detected in F1 DNA Not yet available
sa1125 Nonsense F2 line generated Not yet available
sa15284 Nonsense Available for shipment Available now
sa16554 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa17344
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015996 Nonsense 160 1060 1 14
ENSDART00000135710 Nonsense 163 1060 1 14
Genomic Location (Zv9):
Chromosome 6 (position 19365000)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 22074071
GRCz11 6 18545392
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CAGCCATTGATCATTTTGGATCTAATAAAGAGGGGTTGACCAGATTTTTA[C/T]AAACAGAGATAGATGATGGGGACCACTTGATAGATCAGCMAAAAATGAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40667
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015996 Nonsense 179 1060 1 14
ENSDART00000135710 Nonsense 182 1060 1 14
Genomic Location (Zv9):
Chromosome 6 (position 19364943)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 22074128
GRCz11 6 18545449
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGATAGATGATGGGGACCACTTGATAGATCAGCCAAAAATGAACATTGGC[C/T]AAATCCAAGAGACCTCAAAACATGATCCTATCCAAAACTTGAGGTCCTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1125
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015996 Nonsense 240 1060 2 14
ENSDART00000135710 Nonsense 243 1060 2 14
Genomic Location (Zv9):
Chromosome 6 (position 19364369)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 22074702
GRCz11 6 18546023
KASP Assay ID:
554-1036.1 (used for ordering genotyping assays)
KASP Sequence:
CCAGTGAAAATAGCTGTGAGTTGCTGAAAGACATTCAAAAACTCAATTTG[C/T]AGTTTCCTGTCCAAAGGTTTTTCACCCTTCTTCTGAAGAAGGGAACTTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15284
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015996 Nonsense 328 1060 3 14
ENSDART00000135710 Nonsense 331 1060 3 14
Genomic Location (Zv9):
Chromosome 6 (position 19363990)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 22075081
GRCz11 6 18546402
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTGAGCTATTTTCTGATGTTTTGGTCAACCCTCATTCAAAGTACACAAAC[C/T]GACTGAGTCGAACAAAGTGCAGACAGCAAYAAACTACATTCTGTGYTATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16554
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015996 Nonsense 338 1060 3 14
ENSDART00000135710 Nonsense 341 1060 3 14
Genomic Location (Zv9):
Chromosome 6 (position 19363960)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 22075111
GRCz11 6 18546432
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTCATTCAAAGTACACAAACYGACTGAGTCGAACAAAGTGCAGACAGCAA[C/T]AAACTACATTCTGTGYTATAGTCACTGAACCAGTACAAAATGACTCTGTT
Associated Phenotype:
Not determined