Busch Lab

ZMP

slc4a5

Ensembl ID:
ENSDARG00000005966
ZFIN ID:
ZDB-GENE-091112-19
Human Orthologue:
SLC4A5
Human Description:
solute carrier family 4, sodium bicarbonate cotransporter, member 5 [Source:HGNC Symbol;Acc:18168]
Mouse Orthologue:
Slc4a5
Mouse Description:
solute carrier family 4, sodium bicarbonate cotransporter, member 5 Gene [Source:MGI Symbol;Acc:MGI:

Alleles

There are 8 alleles of this gene:

Allele Name Consequence Status Availability
sa21891 Nonsense Available for shipment Available now
sa17754 Essential Splice Site Available for shipment Available now
sa9545 Nonsense Available for shipment Available now
sa10270 Nonsense Available for shipment Available now
sa6205 Nonsense Mutation detected in F1 DNA Not yet available
sa41816 Nonsense Mutation detected in F1 DNA Not yet available
sa16760 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa21891
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013784 Nonsense 58 1052 2 24
ENSDART00000142053 Nonsense 36 996 1 21
Genomic Location (Zv9):
Chromosome 11 (position 21444922)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 44980764
GRCz11 10 44827376
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATCGCAAACACGCGTCACGACATTCCCACGATCGCGATAAACACCATAGT[C/T]GACATGAACACGCGGATCCAGAGGAAAACTGCGACCCTGAGGAGGCCGAG
Long Flanking Sequence:
TAATTGAAATTAAGCATAAATTTCGATCGATTTAAAATCGATATCGTGACACCCTTAATCAACACAATACTTTTTTCAAAATGAATGCTTCATTTGAAGATGGCTGTGATATGTGGAACTGAGTATTTATAGTGGCTTAGGATTCATCTGATTGCTGAATCATTAATTGGCTAATGCATGGCCAGCCGTGTTTAATCATAAGCACGTGCTCCTCTCCAAATTAGTTTAGAAATAATCTTCACTTGTTGTGTGTGTTGCCTCCTCCTGTTGAATCGCTGAATGTCTCCTCAATTGTAAGTCGCTTTGGACCAAAGCATCTGATAATGACTGTGTGAAATGTAAATAAACATCGCTTTTACAGCAGAGCTTCACCTGTGTGTGTTTGTCTGCTTGTAGAGTCCGTCTACATCGGCGTTCCTGTGCCCAGGAGCTACAGAAGGAAACGCAGACATCGCAAACACGCGTCACGACATTCCCACGATCGCGATAAACACCATAGT[C/T]GACATGAACACGCGGATCCAGAGGAAAACTGCGACCCTGAGGAGGCCGAGCAGGAGAACGAGCTCTCAGATGTCAACTCTACCGGTAAGAATCTGTAAACACTACTACAGTATAACTCTACGTTTCCATAACAGCGTCGAATCTGCGCACTGTACTGCTGCAAATGATACAACGACACGACTCTAGGGGCGTCTCAGATACAGGGCTAAACAGACTTGACGAAAACAGTCTGCAGAAACAATTTGATTGACACTCTATTTGTACGTGTCATCAGCGAGGGAAAGCCCCCCCCACTAGTGCCCATCTCTTCACCTCATTAGCATAAACAGCAGCCCTGAGTGAGAAGCAGCTGTCTGTCTATTAGCCGTTAGAGTGTTTGCATCAAGCACACACCTGACCAGCATTGACAACACAGCTAGTGCTGTTTTACATCTGCCGCAGCATTTGTAGCTCCGCCCTCTTCTAAAAAGAGCTCAATCTCATTTGCATTTAAAGTGACA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa932
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013784 Nonsense 284 1052 7 24
ENSDART00000142053 Nonsense 228 996 5 21
Genomic Location (Zv9):
Chromosome 11 (position 21422098)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 45003588
GRCz11 10 44850200
KASP Assay ID:
554-0837.1 (used for ordering genotyping assays)
KASP Sequence:
CTTCTCAGTGCCGCAGTATGAATGATATTTCCGTCACACCCAGCAGTGAC[C/T]AGGTAGAGTTTTATATCAGTATTGTTTATTATGWCATTTTAATTACATTT
Long Flanking Sequence:
ATATATCTGTTTAATAAATCTGTTTTGTTTAAATGCACCAAAATACACTGAGAAATGGAGGAAAATATTCATCTTCAAAATGGGCTGTAATGTTTGTTTGTTTTTTTAAATAAAAACTTCCCAGGTTCTGCAGGTTGCAGTGTCCTGAACTTTGCCAATTTAAGCCAATCTTAAGCCATTTGTAATCGATTGTTTTGGTTCAATTTGTAATTTTCCCAACCAGTACAGAGGCCAGGGCATCAGAGTGAGTGCTCCGACTTGGCCCCCCTGGTCCAAATGGGCTGTACTTAATCTTGCTGAGCACTGTATTGTTATTTCCTTTCATTTAGTAATTTTATTACTTGTATTAGTTTAAGTTTGGTTCAAATTTAGCATCAGGTTTGACTTTATTCCAGCTCTATGAACAGTTTAATTCAGTAAATAATCAGTGTTTGATCTGTTTTCCAGATCCTTCTCAGTGCCGCAGTATGAATGATATTTCCGTCACACCCAGCAGTGAC[C/T]AGGTAGAGTTTTATATCAGTATTGTTTATTATGTCATTTTAATTACATTTTATATTTATCATTTTTTTATATTTTAAATTTATTTCAATTTTGTAAATTTACTTACATATATTTTTAATTAAATGTATTATTTTTTACAGTATCTTTTCTTTCACATAAACACTGAAATACATTTATTTATTTATTTATTTATTTATGTATTTTATTACATTTTATAAACCTATATGTTTTTTTTTATTTAATTAATTAATTTATATTTTTATTTTTTCATATATTTGTTAATATTTATTTTTTTAATTTGTATTTTATTTTTTTATTTTTTATATTTAAAGTTTTATTTAATGAATTCTTATTTATTTTTAAATATATTTTTTAAAATTATATATTGCTGTAATTTTGATTTTAATAATTTTGTATTTTTCCATTTGTTTATATTTTTTATTTATTTAAATTTTGTAAATGTATTTACATGTATATTAAATACATTTTTGATGAACACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17754
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013784 Essential Splice Site 519 1052 None 24
ENSDART00000142053 Essential Splice Site 464 996 None 21
Genomic Location (Zv9):
Chromosome 11 (position 21401721)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 45023965
GRCz11 10 44870577
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
YGCCATTACTTTTGGGGGACTATTGGGGGACGCCACCGACAACTACCAGG[T/C]GCTGTTTTCATATACAGTGCACAGCATAAMCGAGTCCACCCTTCACAGAT
Long Flanking Sequence:
TTAGAACTGAAGTTTTGAGGCAAATCTTTGCTGTTAAAAATCTGTCATGTAAATAGTGAACGTGCCATTGCGCAACACAACTCACTCTTAAAGGGAATGGGAGATGAAATTCTGTTTTAATGCATGTTTAATGCCCAAAAGACACCCCATAACTCATTAAGAAAATATGACAACTGGTTTAGACCAGGCGCCTGGTGCACAGACAGCTTTTACCACCCTTAAAACAGCAAAATGGACTTAGACATGCTCTAAGTGAAACTGCGTCATGTGTTTCAGACCCTGCACTTAACTTGTTAAAATAGAGCTCTGTATGTGTTTGAGCAGGTTCTGTGGAGGACTCTGGCTAGACATCAAGCGGAAAGCACCCTGGTTTTTCAGCGATTTCTATGAAGGTTTCCACATCCAGTCGGTGTCCGCGGTGCTCTTCATCTACCTGGGCTGCATCACCAATGCCATTACTTTTGGGGGACTATTGGGGGACGCCACCGACAACTACCAGG[T/C]GCTGTTTTCATATACAGTGCACAGCATAAACGAGTCCACCCTTCACAGATCTCTCTTTATATTAAAAGTTTCTACAAGATCATTTTGAGCTTGGATGATGGTTCTCTTACTAAAATTAAAAAATCTTGGGAAAATGAATTGGGAATATGTTTTGAGGAAGAATGGTGGCTTGGTGCGCTGCAGAGAATACATTCTAGTACAATTTGTGCTTGGCTTAGTCTGATACAGTTCAAAGTAGAGGTCTGCATAAATTTCCGAATAAATCGCGGGAGCGGTCGGTAACGGGTTTAATTTGGGACGGGAGCAGGCTGTCTAGCAATATCGTGGATATTGCTATGCGAATGAGAGAGAGAGAGAGAGAGAGAGAGCTTTGCCTGTGTGTGTGCTTGGTGCTTGTGTGTGTGTGTGTTAGTGCGCGCGAATGAGAAAGAGAGAGAGAGCTTTCCCAAATAGCAAAATACACTCGGGCCAGTTCCGGCTAGATTCTCGCCTGCCGGAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9545
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013784 Nonsense 584 1052 14 24
ENSDART00000142053 Nonsense 529 996 12 21
ENSDART00000013784 Nonsense 584 1052 14 24
ENSDART00000142053 Nonsense 529 996 12 21
Genomic Location (Zv9):
Chromosome 11 (position 21395901)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 45029785
GRCz11 10 44876397
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ACATCGACTACATGGAGATCCGTCTGTGGATCGGTTTGCACTCCTGCCTG[C/T]AGTGYCTGATTCTRGTGGCCACAGATGCGARTTATATCATCAAATATATG
Long Flanking Sequence:
TATAAATATATATTTCTTGCAAAATTTTAAAAGATATGTAGCTCATCCCGGAACTTTACCTTGATCTTCAGTGGAAATGTTCATATCTATATACTTACATCCACATTCATAACTGTTTGGCGCCATCTTGTGTCTTAATAATGTGTAGGTTAGTGTATACTCCATCAGCTATTTTCATTTTTGTCAGCTTAGCGTTTAATTAAAGTATTAATAAACCATTATGGCTCAAAAAATAGATTTTTATCTAATAGTTGTGCCATGTAATAATCAAGATAAAGCACATCCTGGACAGTTGTTTATTGTTTGTTGTTTACCCTTCAGTCTTATACACCTGTCAGGCTTTATTCTGAGATAACAGCCTACTTGATCTACTTTATCACTAACTTCTATTGAAAATTTAGAGTACAGTTTTAAAGTTCAGTCTGTTTTCATTTGTGTTCAGAAACAACAACATCGACTACATGGAGATCCGTCTGTGGATCGGTTTGCACTCCTGCCTG[C/T]AGTGTCTGATTCTAGTGGCCACAGATGCGAGTTATATCATCAAATATATGACACGCTTTACAGAGGAGGGTTTCTCCAGCCTCATCTCCTTCATCTTCATCTCTGACGCCCTCAAGAAGATGATGAGCACCTTCAGCTATTACCCCATCAGCCCAGACTTTAAGCCCGACCTCATCATTAGCTACAGGTGTGACTGCCAGCTTCCGGACCAGGGTGAGGCAAAACACATGGCCACAATAGCAGAGTTGACCATAACAGAGTTGACGGTAACACAGTTGACAGTAAAGAAGTAGACGATATTAGAGTTGATGGTAGCAGAATTGACGGTAGCAGAGTTAATGATAATTGGATTGACGTTAGCAGAGTTGACGGTAACAAAGTTGATGGTATCGGAGTTGACGGTAGCGAAGTTGACGATTTCAGAGTTGAAGGCAGCAGAGTTGACCATGAAAGAGTTGACGGTGTCAGAATTGACCGTAGCGGCGTTGACGGTAACACAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10270
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013784 Nonsense 584 1052 14 24
ENSDART00000142053 Nonsense 529 996 12 21
ENSDART00000013784 Nonsense 584 1052 14 24
ENSDART00000142053 Nonsense 529 996 12 21
Genomic Location (Zv9):
Chromosome 11 (position 21395901)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 45029785
GRCz11 10 44876397
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ACATCGACTACATGGAGATCCGTCTGTGGATCGGTTTGCACTCCTGCCTG[C/T]AGTGYCTGATTCTRGTGGCCACAGATGCGARTTATATCATCAAATATATG
Long Flanking Sequence:
TATAAATATATATTTCTTGCAAAATTTTAAAAGATATGTAGCTCATCCCGGAACTTTACCTTGATCTTCAGTGGAAATGTTCATATCTATATACTTACATCCACATTCATAACTGTTTGGCGCCATCTTGTGTCTTAATAATGTGTAGGTTAGTGTATACTCCATCAGCTATTTTCATTTTTGTCAGCTTAGCGTTTAATTAAAGTATTAATAAACCATTATGGCTCAAAAAATAGATTTTTATCTAATAGTTGTGCCATGTAATAATCAAGATAAAGCACATCCTGGACAGTTGTTTATTGTTTGTTGTTTACCCTTCAGTCTTATACACCTGTCAGGCTTTATTCTGAGATAACAGCCTACTTGATCTACTTTATCACTAACTTCTATTGAAAATTTAGAGTACAGTTTTAAAGTTCAGTCTGTTTTCATTTGTGTTCAGAAACAACAACATCGACTACATGGAGATCCGTCTGTGGATCGGTTTGCACTCCTGCCTG[C/T]AGTGTCTGATTCTAGTGGCCACAGATGCGAGTTATATCATCAAATATATGACACGCTTTACAGAGGAGGGTTTCTCCAGCCTCATCTCCTTCATCTTCATCTCTGACGCCCTCAAGAAGATGATGAGCACCTTCAGCTATTACCCCATCAGCCCAGACTTTAAGCCCGACCTCATCATTAGCTACAGGTGTGACTGCCAGCTTCCGGACCAGGGTGAGGCAAAACACATGGCCACAATAGCAGAGTTGACCATAACAGAGTTGACGGTAACACAGTTGACAGTAAAGAAGTAGACGATATTAGAGTTGATGGTAGCAGAATTGACGGTAGCAGAGTTAATGATAATTGGATTGACGTTAGCAGAGTTGACGGTAACAAAGTTGATGGTATCGGAGTTGACGGTAGCGAAGTTGACGATTTCAGAGTTGAAGGCAGCAGAGTTGACCATGAAAGAGTTGACGGTGTCAGAATTGACCGTAGCGGCGTTGACGGTAACACAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6205
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013784 Nonsense 630 1052 14 24
ENSDART00000142053 Nonsense 575 996 12 21
Genomic Location (Zv9):
Chromosome 11 (position 21395761)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 45029925
GRCz11 10 44876537
KASP Assay ID:
554-5122.1 (used for ordering genotyping assays)
KASP Sequence:
TTCATCTTCATCTCTGACGCCCTYAAGAAGATGATGAGCACCTTCARCTA[T/G]TACCCCATCAGCCCAGACTTTAAGCCCGACCTCATCATYAGCTACAGGTG
Long Flanking Sequence:
ATGTGTAGGTTAGTGTATACTCCATCAGCTATTTTCATTTTTGTCAGCTTAGCGTTTAATTAAAGTATTAATAAACCATTATGGCTCAAAAAATAGATTTTTATCTAATAGTTGTGCCATGTAATAATCAAGATAAAGCACATCCTGGACAGTTGTTTATTGTTTGTTGTTTACCCTTCAGTCTTATACACCTGTCAGGCTTTATTCTGAGATAACAGCCTACTTGATCTACTTTATCACTAACTTCTATTGAAAATTTAGAGTACAGTTTTAAAGTTCAGTCTGTTTTCATTTGTGTTCAGAAACAACAACATCGACTACATGGAGATCCGTCTGTGGATCGGTTTGCACTCCTGCCTGCAGTGTCTGATTCTAGTGGCCACAGATGCGAGTTATATCATCAAATATATGACACGCTTTACAGAGGAGGGTTTCTCCAGCCTCATCTCCTTCATCTTCATCTCTGACGCCCTCAAGAAGATGATGAGCACCTTCAGCTA[T/G]TACCCCATCAGCCCAGACTTTAAGCCCGACCTCATCATTAGCTACAGGTGTGACTGCCAGCTTCCGGACCAGGGTGAGGCAAAACACATGGCCACAATAGCAGAGTTGACCATAACAGAGTTGACGGTAACACAGTTGACAGTAAAGAAGTAGACGATATTAGAGTTGATGGTAGCAGAATTGACGGTAGCAGAGTTAATGATAATTGGATTGACGTTAGCAGAGTTGACGGTAACAAAGTTGATGGTATCGGAGTTGACGGTAGCGAAGTTGACGATTTCAGAGTTGAAGGCAGCAGAGTTGACCATGAAAGAGTTGACGGTGTCAGAATTGACCGTAGCGGCGTTGACGGTAACACAGTTGACCATAGCAGAGTTGACGGCAGCAGATTTGATGGTATCGGAGTTGACGGTAGCGGAGTTGATGATACAGGAGTGGACGGTAGCAGAGTTAATGATAACTGGATTGACGATAACAAAGTTGACGGTAACAAAGTTGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41816
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013784 Nonsense 795 1052 18 24
ENSDART00000142053 Nonsense 740 996 16 21
Genomic Location (Zv9):
Chromosome 11 (position 21386761)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 45038925
GRCz11 10 44885537
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CGTCCTGACCGTGGCTGGATCGTGATGCCGATGGGCAGGAACCCGTGGTG[G/A]ATGTGTTTGGCCAGTTTTGTTCCTGCTCTGCTGGTCACCATTCTCATCTT
Long Flanking Sequence:
CAAGTCCATATTTTGACCCACAGAACTCATGTAAACGTTCCCGGAAGCACTTGAAGGCATCGATGGTGTCCGTTTCCTCTTCTTGTCTGGTTTTGATCTGGTTTATTAGTGTGTTTTTCTGCATCTCTGTCTTTCTGTTCTCTATACTCGTGCAGCTTCGGAAACTCATCAGTGATTTTGCAATCTTCACATCAATCATGACTTTTGTTGGTCTCGATATGTTTATGGGACTTAAAACACCCAAACTGATTGTGCCGACTGAGTTTAAGGTACGTGCTGCTGTAACCCTGATCTGATCTGATTCTGTACTAATATTAGACAATCATCACATTCATACACACTGCTGGATCATGAACTGTGTGCTCTGTACATGTGACTACCACTGGATATTGCTGTACTGACATCTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTTCAGCCGACGCGTCCTGACCGTGGCTGGATCGTGATGCCGATGGGCAGGAACCCGTGGTG[G/A]ATGTGTTTGGCCAGTTTTGTTCCTGCTCTGCTGGTCACCATTCTCATCTTCATGGATCAGCAGATCACCGCCGTCATCGTCAACCGCAAAGAAAACAAACTCAAGGTGTTCAGTCACACAGCTGCTGTTAGATTTTGTTACCAAAAATAGATATATATGTACTATATACAGGATTGCAAAACGTAAACTCAGAATTGTGAAATGTAAAGTCAGAGTTGTGAAACCCAAAGTCAGAATTGCCAAGTGTAAACAGAATTGTAAGATGTTAAGTCATAATTGTGAAACAAACTCAAAATTGCAAGATGTAAATTTAGAATTGCGAAACGTAAAGTCTGAGTTACGAGACGTAAACTTCGAATTGCAAAACCCAAAGTCAGAATTGCGAGACATAAACTCAGAATTGTGAAACGTAGTCAGAATTGCAAAATGTAAAGGTAGAATTGTGAAACGTAAACTCAGAATAGTGAGATGTAAAAGTCAAAATTGCGAGACGTAAACTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16760
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013784 Nonsense 828 1052 18 24
ENSDART00000142053 Nonsense 773 996 16 21
Genomic Location (Zv9):
Chromosome 11 (position 21386664)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 45039022
GRCz11 10 44885634
KASP Assay ID:
2260-4193.1 (used for ordering genotyping assays)
KASP Sequence:
TCTTCATGGATCAGCAGATCACCGCYGTCATCGTCAACCGCAAAGARAAC[A/T]AACTCAAGGTGTTCAGTCACACAGCTGCTGTTAGATTTTGTTACCARAAA
Long Flanking Sequence:
CTGGTTTATTAGTGTGTTTTTCTGCATCTCTGTCTTTCTGTTCTCTATACTCGTGCAGCTTCGGAAACTCATCAGTGATTTTGCAATCTTCACATCAATCATGACTTTTGTTGGTCTCGATATGTTTATGGGACTTAAAACACCCAAACTGATTGTGCCGACTGAGTTTAAGGTACGTGCTGCTGTAACCCTGATCTGATCTGATTCTGTACTAATATTAGACAATCATCACATTCATACACACTGCTGGATCATGAACTGTGTGCTCTGTACATGTGACTACCACTGGATATTGCTGTACTGACATCTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTTCAGCCGACGCGTCCTGACCGTGGCTGGATCGTGATGCCGATGGGCAGGAACCCGTGGTGGATGTGTTTGGCCAGTTTTGTTCCTGCTCTGCTGGTCACCATTCTCATCTTCATGGATCAGCAGATCACCGCCGTCATCGTCAACCGCAAAGAAAAC[A/T]AACTCAAGGTGTTCAGTCACACAGCTGCTGTTAGATTTTGTTACCAAAAATAGATATATATGTACTATATACAGGATTGCAAAACGTAAACTCAGAATTGTGAAATGTAAAGTCAGAGTTGTGAAACCCAAAGTCAGAATTGCCAAGTGTAAACAGAATTGTAAGATGTTAAGTCATAATTGTGAAACAAACTCAAAATTGCAAGATGTAAATTTAGAATTGCGAAACGTAAAGTCTGAGTTACGAGACGTAAACTTCGAATTGCAAAACCCAAAGTCAGAATTGCGAGACATAAACTCAGAATTGTGAAACGTAGTCAGAATTGCAAAATGTAAAGGTAGAATTGTGAAACGTAAACTCAGAATAGTGAGATGTAAAAGTCAAAATTGCGAGACGTAAACTCTGAATTGTTTGACGTAAACTCAGAATTGCAAAACATGAACTCAGAAGTGCGAGACATAAATTAAAAATTACAAAACGTAAAGTCAGAATTGCAAAAT
Associated Phenotype:
Not determined