Busch Lab

ZMP

ankmy2a

Ensembl ID:
ENSDARG00000005948
ZFIN ID:
ZDB-GENE-030131-6321
Description:
ankyrin repeat and MYND domain-containing protein 2 [Source:RefSeq peptide;Acc:NP_956188]
Human Orthologue:
ANKMY2
Human Description:
ankyrin repeat and MYND domain containing 2 [Source:HGNC Symbol;Acc:25370]
Mouse Orthologue:
Ankmy2
Mouse Description:
ankyrin repeat and MYND domain containing 2 Gene [Source:MGI Symbol;Acc:MGI:2144755]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa22692 Essential Splice Site Available for shipment Available now
sa17236 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa22692
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003674 Essential Splice Site 177 421 5 11
Genomic Location (Zv9):
Chromosome 15 (position 33882527)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 34728303
GRCz11 15 34586272
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGGACCGCTACACAAAATTATCATGAGTACCAACCTCAATCCTGTAAAGG[T/C]ATCAGGCCATGTTTTCTTTTCCAGTCCTGTTCATTTCTCTCCTTTCTCTA
Long Flanking Sequence:
ATAAGAATATGAAAGTATTAACTGTAAGTGTAAAACAACCAACAAAACCATCCATGACATTCTTAAGTAAATCCTCTTGTCAGGATAGAAGCAATATCAAAGTCATCAAGGTTCCTAAATATTATGGTAAGCTCTATTTTTACTATGTTCAATACAAGTCAGATATTCAAGAATGGTTTGATGCCACATCCCTCAAGAGGGAGCCATATCTGAGATTTATTGTAAAAGTATACATTTTCTTACATTAAGAATAAGAAAATCGGAAAGCCTCATTTTTCACCTAAGACTTGCAGAAGGAAAGGTACTGTACATTTGAAAATAGTTTCAATATTTTTCAGGACAGCACGATTGCGTGACAGTCATCAATAACTTCTTCTCCCGGGCGAGGTTGGACTACTACACAAAACCTCAGGGGCTGGAAAAGGAACCAAAACTTCCTTCAAAACTTTCTGGACCGCTACACAAAATTATCATGAGTACCAACCTCAATCCTGTAAAGG[T/C]ATCAGGCCATGTTTTCTTTTCCAGTCCTGTTCATTTCTCTCCTTTCTCTATTCCTTTTGTCTGATTCTATACTCTCATATCCATATTAAGAAATAGCAGTAAATAAATATAACTTTAAAGGTGCACTGAAGTGCAAATTTTCGTATGCATTTTTTACGTATTCATATGCGAAAGCTAACTTTGCACACTAATGCATATTAATAATCCAAAAAACACAAAACATTTTGGAGTCAGTTCAAGCTGTGATACTTTTTTTTTCTCTTTCTCCAAAGTAGTAAAACAAAGAGCAATAGGCTGCATATTGTGTTCATTCAATATTAGAGAGGAAGGAGAGTTTAGTTCATTATCAAAGAGCTGCGCTACAATTATCCTAAAATGTAAAGTTTATTTCAGGAGATCAGTGAAATTTTGATACATTGCTTGTGATACTTCACACCTTCACGTCCTGAACAGACACATCCTGAACAGACATTGGCAGTACCTATATACATTATAATAGA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa19120
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003674 Nonsense 293 421 8 11
Genomic Location (Zv9):
Chromosome 15 (position 33876353)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 34722129
GRCz11 15 34580098
KASP Assay ID:
2260-8801.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACTGTGATGCCACATTACTTCAGCAGCTGGTCCGGAGTATCGCTCCAGTG[G/T]AAATTGTGAGTAAGAGTTACAGAGACCTCTGTTTGCTCACGTAGAGGTAA
Long Flanking Sequence:
TTTAATAATACTACTACTTCAAATGATAATAGTAAAATAGATGTTTCTTAAAAAAGCAAAGTGAGATATTAGATTAATTTCTGAAGAATCATGTGACATTGGAATAGTGATGATTAAAAAATAGCTTTGCCTAGAAAATAAAGATGTATTAAAATAGAAAATGATTTTATTTAATTATTTAATATTAGTTTCAGAGTTTGTATTCTAATAAATGCATGGCTGAGCATAATTTTATAATGCTGGCAAAAGCTTATTCACCCTAAATATTTAGGAATATAAACATATTTAATTTTAACTTCAAAGGGGCTTTGTTTTTATTAATTTAAAATGCCTTATTTGATCTGTACAGTGACTGAAATTTTTTTCTCAGTCTTTTAAAAGGGCGAGACAGTGATGGTTTCCCAGTATTCCAGGAGAAGTTCATTCGCGAGTGCATTAGGAAGTTTCCATACTGTGATGCCACATTACTTCAGCAGCTGGTCCGGAGTATCGCTCCAGTG[G/T]AAATTGTGAGTAAGAGTTACAGAGACCTCTGTTTGCTCACGTAGAGGTAAATCTACTTATTTGTTTGGATTAACTTGTTTAAGTGAGCTGTTTTAGTGGTCTAACATAGGAAAGTGAGTGAGGGAACAATACATTATTTTCAAATAAATCTTTAGTCTCAGCTACCAAGACAGAACATTATTTCATTATTACTTATTTATTTTATTTTATTTTGACAGGGAAGTGACCCAACGGCTATGTCAGTTCTCACTCAGGCCATCACGGGCCAGGTGGGTTTCATGGATGCAGATTTCTGCACAACCTGTGGTGAGAAAGGGGCAGAGAAAAGATGCTCCATCTGCAAAATGGTAAATATCAGGCTTTATAACATGATTTATTCACTTCACTCTAGGTCTGCACTATATTGGAAAAATCTGACATTGCTATATATTAGTGCTGTCAATCGATTAAAAAAAATTAACTAATTAATCGCACCTTTTTAAATTAATCGCATTTAAAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17236
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003674 Essential Splice Site 294 421 8 11
Genomic Location (Zv9):
Chromosome 15 (position 33876346)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 34722122
GRCz11 15 34580091
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGCCACATTACTTCAGCAGCTGGTCCGGAGTAWCGCTCCAGTGGAAATTG[T/A]GAGTAAGAGTTACAGAGACCTCYGTTTGCTCACKTAGAGGTAAATCTACY
Long Flanking Sequence:
ATACTACTACTTCAAATGATAATAGTAAAATAGATGTTTCTTAAAAAAGCAAAGTGAGATATTAGATTAATTTCTGAAGAATCATGTGACATTGGAATAGTGATGATTAAAAAATAGCTTTGCCTAGAAAATAAAGATGTATTAAAATAGAAAATGATTTTATTTAATTATTTAATATTAGTTTCAGAGTTTGTATTCTAATAAATGCATGGCTGAGCATAATTTTATAATGCTGGCAAAAGCTTATTCACCCTAAATATTTAGGAATATAAACATATTTAATTTTAACTTCAAAGGGGCTTTGTTTTTATTAATTTAAAATGCCTTATTTGATCTGTACAGTGACTGAAATTTTTTTCTCAGTCTTTTAAAAGGGCGAGACAGTGATGGTTTCCCAGTATTCCAGGAGAAGTTCATTCGCGAGTGCATTAGGAAGTTTCCATACTGTGATGCCACATTACTTCAGCAGCTGGTCCGGAGTATCGCTCCAGTGGAAATTG[T/A]GAGTAAGAGTTACAGAGACCTCTGTTTGCTCACGTAGAGGTAAATCTACTTATTTGTTTGGATTAACTTGTTTAAGTGAGCTGTTTTAGTGGTCTAACATAGGAAAGTGAGTGAGGGAACAATACATTATTTTCAAATAAATCTTTAGTCTCAGCTACCAAGACAGAACATTATTTCATTATTACTTATTTATTTTATTTTATTTTGACAGGGAAGTGACCCAACGGCTATGTCAGTTCTCACTCAGGCCATCACGGGCCAGGTGGGTTTCATGGATGCAGATTTCTGCACAACCTGTGGTGAGAAAGGGGCAGAGAAAAGATGCTCCATCTGCAAAATGGTAAATATCAGGCTTTATAACATGATTTATTCACTTCACTCTAGGTCTGCACTATATTGGAAAAATCTGACATTGCTATATATTAGTGCTGTCAATCGATTAAAAAAAATTAACTAATTAATCGCACCTTTTTAAATTAATCGCATTTAAAATACTAAAA
Associated Phenotype:
Not determined