Busch Lab

ZMP

slc16a9b

Ensembl ID:
ENSDARG00000005947
ZFIN ID:
ZDB-GENE-040801-69
Description:
solute carrier family 16 (monocarboxylic acid transporters), member 9 [Source:RefSeq peptide;Acc:NP
Human Orthologue:
SLC16A9
Human Description:
solute carrier family 16, member 9 (monocarboxylic acid transporter 9) [Source:HGNC Symbol;Acc:23520
Mouse Orthologue:
Slc16a9
Mouse Description:
solute carrier family 16 (monocarboxylic acid transporters), member 9 Gene [Source:MGI Symbol;Acc:MG

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa9331 Nonsense Mutation detected in F1 DNA Not yet available
sa19027 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa9331
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025669 Nonsense 204 486 5 6
ENSDART00000146685 None None 61 None 1
ENSDART00000025669 Nonsense 204 486 5 6
ENSDART00000146685 None None 61 None 1
Genomic Location (Zv9):
Chromosome 12 (position 8255347)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 7561522
GRCz11 12 7595644
KASP Assay ID:
2260-4962.1 (used for ordering genotyping assays)
KASP Sequence:
GCGCCGGACTCATGCGCCCKYTGCACCTGCCGGCCTACTACCTRAAACAA[C/T]GAGCRGCGATGGYCGAGAAAGCCGAGGAGAACGTTCTGGAAAAAWCTYCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19027
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025669 Nonsense 204 486 5 6
ENSDART00000146685 None None 61 None 1
ENSDART00000025669 Nonsense 204 486 5 6
ENSDART00000146685 None None 61 None 1
Genomic Location (Zv9):
Chromosome 12 (position 8255347)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 7561522
GRCz11 12 7595644
KASP Assay ID:
2260-4962.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCGCCGGACTCATGCGCCCGCTGCACCTGCCGGCCTACTACCTAAAACAA[C/T]GAGCGGCGATGGCCGAGAAAGCCGAGGAGAACGTTCTGGAAAAATCTCCT
Associated Phenotype:
Not determined