Busch Lab

ZMP

tbc1d17

Ensembl ID:
ENSDARG00000005927
ZFIN ID:
ZDB-GENE-050522-79
Description:
TBC1 domain family member 17 [Source:RefSeq peptide;Acc:NP_001019565]
Human Orthologue:
TBC1D17
Human Description:
TBC1 domain family, member 17 [Source:HGNC Symbol;Acc:25699]
Mouse Orthologue:
Tbc1d17
Mouse Description:
TBC1 domain family, member 17 Gene [Source:MGI Symbol;Acc:MGI:2449973]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa33193 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa33193
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017422 Essential Splice Site 107 639 4 17
ENSDART00000077057 Essential Splice Site 107 582 4 16
ENSDART00000134395 Essential Splice Site 107 582 4 16
Genomic Location (Zv9):
Chromosome 3 (position 30333889)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 30051928
GRCz11 3 30182770
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACAGTCAAGCAGGACAGACGGCAGGAGCAGCCACCGGTCAGAGAAACCGG[T/C]ATTGCGTTAAACCCACACTAGTCAAAATGATACATCTCATGCATTTACAT
Long Flanking Sequence:
ACTACAAAATTTTACACCTTTACATCGGACCGTTTCTTTCTTTAATTCACTCACAGTGTGCTGTTAAGACCCCACTGCCTTAACCGCGTCAGCTAAACTCTCCCACTCTATTTATTTATTTTGTTATTAATTCCGGAGAAAAAACTTGCAAATAACATAATAGTTTTTCTCTGGTTTCTCTTGAGAATATGCGTGGGATTTTGCATACGTAGTGTTTCATACATCTGAATTTTTTACTGCGTACGCAGATTTACAGCTCTGTGTGTACCAATGTTTTAGTATGAATTCAACGCAAATCTTCATACATGAGGCTCCTGATGTTTGTGATTGTTTTCTACATGACTTATATCTCTTAATCTCTTAAATGTTGTCTCCTGAAAGGATGGAGAAGGAGGAGAGGAGGAGACCAAGTTTGACCCTGGTTATGAGCCAGACTGGGCCGTCATCAGTACAGTCAAGCAGGACAGACGGCAGGAGCAGCCACCGGTCAGAGAAACCGG[T/C]ATTGCGTTAAACCCACACTAGTCAAAATGATACATCTCATGCATTTACATACATGCTCATAAATATTGATGTTTGCAGGTCACTGGAGCTCGTTCTCTCTGCCACTGTCAGAGCTGTACTCTCTCCGGAGGGCTCGCTTCTCCCTGGGCAGGAACTTCTTGGTTCTGACCACCAGAGGGGGTGATCCTCTCCCTCCTCTGCACTTCCATCGTGGAGGCACCAGAGAGCTGCTCAAAGCCATGCAGCGCTACATCAGACTTGCCCCGTGAGTGCCATATACATGTATTTTTACCAGTCCTCACCAGTAAAAAAAAAAAAAAAACAATTTACAAAATATTGTAAAAAAAAAAAAGGGACTGATACTGTAGCACTGTAAAATACATTTACACTTTAATTTAAAACATTAGCATATCAAGCTTTTATTTTGACAGGCTGATTGCAGATAGAAAGTTTCAGAGTGAAGTGCATCACATTTTTGTTTTCATATACATTTCAATGTA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa5208
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017422 Essential Splice Site 410 639 11 17
ENSDART00000077057 None None 582 None 16
ENSDART00000134395 None None 582 None 16
Genomic Location (Zv9):
Chromosome 3 (position 30326132)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 30044171
GRCz11 3 30175013
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ACTGCTCCATGATGTGTTGATGACGTACTGCATGTACAATTTTGATCTAG[G/A]TAGGAGCAAGTGATTTGTTGTTGTAATTCCAYCTGCTYACCACTAGAGAA
Long Flanking Sequence:
AAATGTGAATCACAATTATTTGGCCATTAATCAGCACAAAATTAATAATTTTAATCTACTATATGCTAAATATGAGCAAAAAATTATAATCGACTTGACTAATAATACAGTGTCTACCTGCTTTTCGCACACACTTGAGCACCACTGAAGTTATTCTTTATACTTTTTTATTTGATCATGTTTACATTAGTTGTTTTCCACTGCAGGGATGAGTATTTCAGGATGAAGGTTCAGTGGAAATCAGTGAGTGAAGAGCAGGAGATGAGAAACTCTCTTTTCAGAGGATACCGGAGTCTCATTGGTATGTTCAGCAATGTGACTGATTTTCTAATAACTCTTGTTGTGACCTATGCCTTATTAACCGCTGCTCTCTAATTGGACAGAACGGGATGTGAATCGAACCGACAGACACAACTCCTTCTTCTCTGGGAATGAGAACCCAGGACTAACACTGCTCCATGATGTGTTGATGACGTACTGCATGTACAATTTTGATCTAG[G/A]TAGGAGCAAGTGATTTGTTGTTGTAATTCCACCTGCTTACCACTAGAGAATGCTGCAATCTCTCTTTATGGCTTTTTAACTTGTCTTTCAGGTTATGTTCAAGGGATGAGTGATCTCCTGTCTCCTCTGCTCTTTGTTACCCAGAATGAGGTGGAGTCCTTCTGGTGCTTGACAGGTTTTATGGATCTTGTGGTCAGTTTACGCTCTAGTTTTCTGATTAGGGATGGGTTTCGATTCAGATATCAAGAATAGATTTTGACTCACAATCTCTTGATTCAGTTTAATCCTTGATTCGATCCTAGTTTTGATTCAGTTATTATAAATTAAATACAAATGCTACTGATATTTTGAACACTACTTCTACAGCATGGGTACTATAAAGCAGAACACACTTTTATTAAAGATGTATGGAATGAATAGTCAAAGAAAATGATACAACTTTAAAATACGTATAGGGCTGTGCAATACGATGATATTTATATCGTATGGACAGATCAAAG
Associated Phenotype:
Not determined