Busch Lab

ZMP

LOC571099

Ensembl ID:
ENSDARG00000005901
Human Orthologue:
AIM1L
Human Description:
absent in melanoma 1-like [Source:HGNC Symbol;Acc:17295]
Mouse Orthologue:
Aim1l
Mouse Description:
absent in melanoma 1-like Gene [Source:MGI Symbol;Acc:MGI:1334463]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa3003 Essential Splice Site F2 line generated Not yet available
sa11766 Essential Splice Site Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29282
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013972 Nonsense 48 702 2 19
Genomic Location (Zv9):
Chromosome 19 (position 50058595)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 48610457
GRCz11 19 48269851
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAGATGTTGTGGACGCCACGCCATGGGAGTTTACTGACACTATATCAGTA[C/T]GAGTTATTAGAGGAGGGTGAGTGGACTAACACACTCACACTAACACTATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3003
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013972 Essential Splice Site 296 702 9 19
Genomic Location (Zv9):
Chromosome 19 (position 50051359)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 48617693
GRCz11 19 48277087
KASP Assay ID:
554-2512.1 (used for ordering genotyping assays)
KASP Sequence:
GTGGGGCGGAGTCAACTMTGAGCTGCGCTCCGTCAGAGTCATTCAGTCGG[T/G]AAGAAACATCTACRCTSAGCACATACACRCATTTCAGCAGCCATCAGGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11766
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013972 Essential Splice Site 436 702 14 19
Genomic Location (Zv9):
Chromosome 19 (position 50047204)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 48621848
GRCz11 19 48281242
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTTTCAATGGAGCTGAATCCTAATTGTGATTGTAAACCTGTGTTTATTTC[A/G]GCTGGGTGCTGTAYGGAGAAGMGAAGTTCAGCGGCAGCATGTATGTYTTA
Associated Phenotype:
Not determined