Busch Lab

ZMP

RALGAPA2

Ensembl ID:
ENSDARG00000005861
Description:
Ral GTPase activating protein, alpha subunit 2 (catalytic) [Source:HGNC Symbol;Acc:16207]
Human Orthologue:
RALGAPA2
Human Description:
Ral GTPase activating protein, alpha subunit 2 (catalytic) [Source:HGNC Symbol;Acc:16207]
Mouse Orthologue:
Ralgapa2
Mouse Description:
Ral GTPase activating protein, alpha subunit 2 (catalytic) Gene [Source:MGI Symbol;Acc:MGI:3036245]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa17672 Nonsense Available for shipment Available now
sa42984 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa17672
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084745 Nonsense 1618 1916 33 41
Genomic Location (Zv9):
Chromosome 17 (position 41698865)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 41594275
GRCz11 17 41583149
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TCATGGAGGCYGTCCACMGACAGTCAAAACAGGAGGAAGAGGAGTTGATG[C/T]GAAGGCAAATYGAAGACCCCARTGTCAGAGCAGAGAGGCAGARAGAGCCC
Long Flanking Sequence:
TCTTCAAAAGCCCCAATCTGCAGCTCTTCGTCTTTAATGACAGCACGCTCATTTCATACCTGCAGATCCCCTCTGATAATTCCAACACTGCTCCGCTAAGTGCCAACCCCAGGGATCATTCCTCTGAGGTCCGCATCATCATTCGGGACATCTCAGGCAAATACTCATGGGACAGTGGCGTTCTCTTCCGCACTTTAGATGGCACCGGTGTGACTTCCAGCGACAGCAGAGAACAGTCTTCTCATGAAGCTGCTCGATTAGAAAAGCGGAGCTCTGTCCGCTTCAGTAAATGTTCATCAGAGCTGGACGTGGAAGATGGCGTTGATGTGCTGGACCAGCTCCTGGAGGACCTCGGCCACAGCAGTCCCGAGTGTCTGCCGGAACCCCAGCTCAGACTGACCCAGCCACCATCTCCACCCATGGGCATGAACCTGGAGATAGAAGGGCTCATCATGGAGGCCGTCCACCGACAGTCAAAACAGGAGGAAGAGGAGTTGATG[C/T]GAAGGCAAATCGAAGACCCCAGTGTCAGAGCAGAGAGGCAGAAAGAGCCCACACATCAGGAGCCCAAATCCCCTTTCTACCTATGCAGACTCCTCCTCAATGACCTCGGCATGAACTCATGGGATCGCAGGTACTGTACATTGTTCTCTTTGGTTCACATTTCTTTGTTGAAAAAGTCGTGGTCTAATGGTTAGAGAGTTAGAGAGCCAAAGCTTGTAGGTTTAAGCGCAGGTACCAGCAGGGATTGTTAATGGAATATTCATTACATTAACAATCCCTGCTGGTACCTGGGCTCAAACCTACGACATTTGGCTCTCTAACTCTCCACCTCAATACCGTTCAGGTGATTACCTTGAGCAAAGCACCAAACCCCCACTGCTCCCCGAGCAGCCCACTGCTCTGGCTGTGTGTACACAGGTGTAAGTTGCGTTTTTGTAAAAATGTCTGCTAAATGCATTAATGCAATGTAAATGTAATAAATAGTACAATCAAAATGGACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42984
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084745 Nonsense 1716 1916 35 41
Genomic Location (Zv9):
Chromosome 17 (position 41687224)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 41582634
GRCz11 17 41571508
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAAGAGGACAAATATTCCATTCTGTCCAATACACAGGGCAGTCAGGTTTA[T/A]GAGGACTTTGTCTCTGGACTGGGATGGGAGGTGAAATAACACACAAAATT
Long Flanking Sequence:
AGTATATGCCTGCGTGTTTGTTTATACAAAAAAATAAGTACACACACATATATTATGTCAAAACAAACATTTATTCTAGATTTGATTAATCTTTGCCCAGCACAAAAAAGTTTCTAAAAAATACAAATTAAATTCACTTCAAATAAAAACTGAAAATATCCAAAAATAATATATCCACACCTCTAAACAAGCCAAAACAATGTTGGTAATAACTTTACAATTAGAAAAAAATTCTGAAGTGATTACATTGCAAGTATTCAGCTCCTTGTGCTACGACACTTTTAATTTAATACCACAGCTTCAATCTGGGTGGCCTTTCTTCTGATTTATTACATGCACAGATCACTTTCAATATGCCGATTCCTCACATTTCATGTCATGATGTATGTTTGCTTCTTTGTTTCCAGTCGAGAGACACACAAGATAGCAGTCTTCTATATTGGAGAAGGACAAGAGGACAAATATTCCATTCTGTCCAATACACAGGGCAGTCAGGTTTA[T/A]GAGGACTTTGTCTCTGGACTGGGATGGGAGGTGAAATAACACACAAAATTAACTGTTGGATCTGTTGTGAGTCTGTGAATTGGCCAGAGCATCAAGAATCTTCTCTCCATCTTTTTTAGGTGAATCTGGCCACTCACTGTGGGTTTATGGGTGGTTTGCAGAGAAATGGCAGCACAGGAAGCACAGCTCCATATTACGCTACCTCCAATGTGGAGGTCATCTTCCACGTGTCCACTCGGATGCCTTCTGACTCTGATGACTCCATCACTAAAAAGGTAATTGTTTATTTTTAAATGACATTTAAATTTTTGGTCACAATTTATTTTGATCGTCCGTTTGATAAATTTATGTTACTTTGCATCTGTATGCCAACTAATTCTTATTAGGTTATAAGTAGACTGTTAGGTTGAGGTTTGGGTTTGGGTTAGGATTAGTGCAAATTGACATGTACTTGAAAAAGTTTCTTATGGTCAGTTAAAATTTTGTTAAAGGAGCACTAT
Associated Phenotype:
Not determined