Busch Lab

ZMP

cd9a

Ensembl ID:
ENSDARG00000005842
ZFIN ID:
ZDB-GENE-030131-1175
Description:
CD9 antigen [Source:RefSeq peptide;Acc:NP_997784]
Human Orthologue:
CD9
Human Description:
CD9 molecule [Source:HGNC Symbol;Acc:1709]
Mouse Orthologue:
Cd9
Mouse Description:
CD9 antigen Gene [Source:MGI Symbol;Acc:MGI:88348]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa6498 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28971
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019571 None None 227 None 8
ENSDART00000135587 Essential Splice Site 23 228 1 8

The following transcripts of ENSDARG00000005842 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 18 (position 6229453)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 7184554
GRCz11 18 7143516
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAGAGATGTGCGTCAAATACCTGATGTTCGTCTTCAATTTCATCTTCTGG[G/T]TAAGCCCGTGTGTGTTCTGTGTCTGGTGTGTGTGTGTGTGTGTGTGTGTG
Long Flanking Sequence:
CATACATGTCAATGAAAAAAACGTGCAAAGAGAGAGTAAGAAGAACAGTGCAAGAAACCTCAGGGCTTTGCTCTGACTGAGTGACGTCATTCCATCATGACGTAATTCCCAGCGAATAAAGACCGAGGGGCTTTTACCCTTAAAATAAACGAATAGGACAAAAATCCTCGAAAGAGTGAGTCTATTTGCAATTGATTTCGTTGTCTAACCCTTCAAAACAGTTACAGGTGCAGATACTGTCGCAGCTTTGATTTCGCCAATTGCAAAGTTGATGTTTGACAGCAGGACTGAGGCAGTGTGAGTTTGTCTCGGTCGTGAGTTTCCCGTGAGACACACACACACACCGCCGCCTGCGAGACACCGGACGGATCGCTCCCGTGATCTTTACTCTGTCATTCAGCACCGTGTGTGGCGGAGCACAGACTGCTGAGATGGCGGCGCTGACCGGAGGAGAGATGTGCGTCAAATACCTGATGTTCGTCTTCAATTTCATCTTCTGG[G/T]TAAGCCCGTGTGTGTTCTGTGTCTGGTGTGTGTGTGTGTGTGTGTGTGTGTGCAGGGGTTTACTCGCGCTCGGGACGCTGTTTTATATCACTCGCGCTTTTCTCCAGGGGTTTGATTCATTGATAAATAAATGCGTGTGCATGGCGTCCTGTTTGGAAATTGTTAATTGGTTTATTTTGCAATTAATTACGCGGGAACGTCTGTGTGAAGCCATGCAACCGAATTACATCCATTTAGCTGACCTAATTTGAAGGATTTCAGAACCCTTAAAACACCGTGTGTGTTTCTGTGAGAGACGGTTGATGTGTCTTCTGTGTGTATTTTCGGGACAAGCACTGCATTTTGATAGTGTTTTCTGTGACTGCTCTCTGTTCGTGTTTGTTTGCCTCAGCTGTTCTCTCCGACGGCTGGACAGACGCGTTCTTTATGGTGTCCGCTTCCTGAATTAATCATTTGAACCGACTCTCTTAAATGATTCGTTTGAACCGATTCGTCGTTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6498
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019571 Essential Splice Site 89 227 None 8
ENSDART00000135587 Essential Splice Site 90 228 None 8

The following transcripts of ENSDARG00000005842 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 18 (position 6217877)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 7172978
GRCz11 18 7131940
KASP Assay ID:
554-4788.1 (used for ordering genotyping assays)
KASP Sequence:
TTTCGGATGTTGCGGAGCCATCCAGGAGTCCCCTTGCATGCTGGGATTGG[T/C]AATGCACATATYATGCAGCTTGTAATATCTGTATATACARTTGAAGTCAR
Long Flanking Sequence:
TAATTTCCCCGTGGCAGTAATTATCCACAGTCGATTGGCTATAAAAAACTGGGCCAAAACTAAGTGGCCTTAGATGAATGAGCATGTTAAGGGAAGGCTTTTAGACCGATTTACTCCATATCTGCTCCTTTATCTGTTTTTATTTTAATGTCAACATATAATAACTTCGATTTGTGTTCATGTTAATGCATTGGTCAGATAAAGCGATTTGTGTGGTTTTGTTGCAGATCGCAGGCACGGCTGTCTTGGCTGTTGGACTGTGGCTGAGGTTTGATCCCAAGACCAAGAGTTTGTTCGAAGGGGAAAACTCTCCTTATGTCTTCTACACAGGTCAGCAGAGATGTGCTTTAATCAGATGTGATGTGACCGGCTGCCTTCACACTGAGTTGTTTGTGTTGCAGGAGTGTATATCCTCATTGCGGCCGGTGCGCTCATGATGGTGGTGGGATTTTTCGGATGTTGCGGAGCCATCCAGGAGTCCCCTTGCATGCTGGGATTGG[T/C]AATGCACATATCATGCAGCTTGTAATATCTGTATATACAGTTGAAGTCAGAATTATTTGCTCTCCTGAATTATTAGACCCCCTGTATATTTTTCACCAGTTTCTGTTTAATGAAAAGACATTAGAAACATATTTTAATCATAATAGTTTTAATAACTCATTACTAATAAGGAGTTATTTTATCTTTGCCATGATGACAGTACATAACATTTGACTAGATATTTTTCAAGATACTAGTATTCAGCTTAAAGTGACATTTAAAGGCTTAACTAGGTTAATAGAGTGGAGGAACCATGGCGTCACCTTGTAGGCTAATCGGCTGCAAGCATAAAACTGGTTCCCAAGATACAATACCTATAGAAATTCCCAATAGGCTTTTCGAAGATTGCAAATAATAAGCTCTGTGTTCAAACACTGTTCATTACACTTGCACTTTTTGCCCAACCGGATAATCCTCACATGAAAATACAACTTTAAGCACTTTTGTATCTTAAATGCAAT
Associated Phenotype:
Not determined