Busch Lab

ZMP

scn8aa

Ensembl ID:
ENSDARG00000005775
ZFIN ID:
ZDB-GENE-000828-1
Description:
sodium channel, voltage-gated, type VIII, alpha a [Source:RefSeq peptide;Acc:NP_571703]
Human Orthologue:
SCN8A
Human Description:
sodium channel, voltage gated, type VIII, alpha subunit [Source:HGNC Symbol;Acc:10596]
Mouse Orthologue:
Scn8a
Mouse Description:
sodium channel, voltage-gated, type VIII, alpha Gene [Source:MGI Symbol;Acc:MGI:103169]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa31090 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa37728 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa43994 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa12919 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa31090
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022042 Essential Splice Site None 1949 1 27
Genomic Location (Zv9):
Chromosome 23 (position 27585832)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 27418654
GRCz11 23 27345195
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CATCTGCAGTCCAGCGAGGATTTTTTGGATACCCGCTAACGCAATCATAG[T/G]AAGTATTATGTTTAAATAACGCACTGGCGATGCGTTTAGAGGTGCGATTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37728
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022042 Essential Splice Site 680 1949 13 27
Genomic Location (Zv9):
Chromosome 23 (position 27530831)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 27363653
GRCz11 23 27290194
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAGCGAGCAAACAGCGTGATGAGTGCGTTAACCAACACATTGGTTGAAGG[T/A]ATGTCCACATAACATAAAGGCCAATTCACACTCTACCAACAGTCACTACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43994
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022042 Essential Splice Site 1094 1949 18 27
Genomic Location (Zv9):
Chromosome 23 (position 27515948)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 27348770
GRCz11 23 27275311
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTTTACTTAAATAATTTATCTTCACAAATGTCATCTTTCTTTTTGATCA[G/A]TTGGATGACATCAGCTCTTCAGAGGGCAGCACCATAGATATTAAACCAGA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4252
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022042 Nonsense 1490 1949 26 27
Genomic Location (Zv9):
Chromosome 23 (position 27494426)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 27327248
GRCz11 23 27253789
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTTCTCTTGTTTAGAACAAGCTCCAGGGTATGGTGTTTGACTTTGTGACA[C/T]AGCAGGTCTTTGATATTTCCATCATGATCCTCATCTGTTTGAACATGGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12919
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022042 Nonsense 1655 1949 27 27
Genomic Location (Zv9):
Chromosome 23 (position 27493827)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 27326649
GRCz11 23 27253190
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATGTCAAACTTTGCCTACGTGAAGCGGGAGTCTGGCATAGATGACATGTA[T/G]AACTTTGAAACATTTGGCAATAGCATGATCTGCCTGKTCATGATAACCAC
Associated Phenotype:
Not determined