Busch Lab

ZMP

ptprfb

Ensembl ID:
ENSDARG00000005754
ZFIN ID:
ZDB-GENE-060503-530
Description:
Receptor-type tyrosine-protein phosphatase F [Source:UniProtKB/Swiss-Prot;Acc:A4IFW2]
Human Orthologue:
PTPRF
Human Description:
protein tyrosine phosphatase, receptor type, F [Source:HGNC Symbol;Acc:9670]
Mouse Orthologue:
Ptprf
Mouse Description:
protein tyrosine phosphatase, receptor type, F Gene [Source:MGI Symbol;Acc:MGI:102695]

Alleles

There are 6 alleles of this gene:

Allele Name Consequence Status Availability
sa32883 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa2047 Essential Splice Site F2 line generated Not yet available
sa12334 Nonsense Available for shipment Available now
sa19723 Nonsense Available for shipment Available now
sa19722 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa32883
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083314 Essential Splice Site None 1909 1 33
ENSDART00000090341 None None 1870 None 31
ENSDART00000126665 None None 92 None 4
ENSDART00000133709 None None 148 None 3
Genomic Location (Zv9):
Chromosome 2 (position 17599481)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 18156810
GRCz11 2 17827979
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AATTTATTTATTTTTGAGTGGATGTTTTTTTTAATTTCATATTGTTATGG[G/A]TAAGTTTATCAAACACTTTCTGTGATCTATGATTTGTGTGACATGCTCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2047
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083314 Essential Splice Site 129 1909 5 33
ENSDART00000090341 None 95 1870 3 31
ENSDART00000126665 None None 92 None 4
ENSDART00000133709 None None 148 None 3
Genomic Location (Zv9):
Chromosome 2 (position 17499817)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 18057146
GRCz11 2 17728315
KASP Assay ID:
554-2936.1 (used for ordering genotyping assays)
KASP Sequence:
GCTCYTTTAGGCTCCTGACTTGACCTGCTTTTTTNNCTTTCTTTCTTTCTGC[A/T]GAAAATCAGATTCCGCATGGTTTCCCCACCATAGACATGGGTCCTCAGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12334
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083314 Nonsense 187 1909 5 33
ENSDART00000090341 Nonsense 154 1870 3 31
ENSDART00000126665 None None 92 None 4
ENSDART00000133709 None None 148 None 3
Genomic Location (Zv9):
Chromosome 2 (position 17499642)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 18056971
GRCz11 2 17728140
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GGTTTAAAGACTTCCTGCCWGTAGACATCAAYGGCAACGGGCGAATCAAA[C/T]AGCTTCGYTCAGGTAGACTTYCTTACATCCCTACAATCWCTGGAACAAYA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19723
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083314 Nonsense 208 1909 6 33
ENSDART00000090341 Nonsense 176 1870 4 31
ENSDART00000126665 None None 92 None 4
ENSDART00000133709 None None 148 None 3
Genomic Location (Zv9):
Chromosome 2 (position 17488555)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 18045884
GRCz11 2 17717053
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCTCTGCAGATTGAAAACAGCGAGGAATCAGACCAGGGCAAGTACGAATG[T/A]GTGGCTACGAATAGCGCCGGGACGCGTTATTCAGCTCCGGCTAATCTCTA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa25790
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083314 Nonsense 544 1909 9 33
ENSDART00000090341 Nonsense 512 1870 7 31
ENSDART00000126665 None None 92 None 4
ENSDART00000133709 None None 148 None 3
Genomic Location (Zv9):
Chromosome 2 (position 17472572)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 18029901
GRCz11 2 17701070
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGGATCCTACTAACTTGGCTGTGGCCCGTGCAGGACCCCATCATCAAATA[C/A]GAGCTGCAATATTGGGAGGCTGACTCAGACAACAAGGTATCATGCCAGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19722
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083314 Essential Splice Site 556 1909 9 33
ENSDART00000090341 Essential Splice Site 524 1870 7 31
ENSDART00000126665 None None 92 None 4
ENSDART00000133709 None None 148 None 3
Genomic Location (Zv9):
Chromosome 2 (position 17472534)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 18029863
GRCz11 2 17701032
KASP Assay ID:
2259-1828.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CATCATCAAATACGAGCTGCAATATTGGGAGGCTGACTCAGACAACAAGG[T/A]ATCATGCCAGTGCTTGTTTCTGCCCTATTCATTGAGAATTGCAAGCAGAC
Associated Phenotype:
Not determined