Busch Lab

ZMP

gpm6ba

Ensembl ID:
ENSDARG00000005739
ZFIN ID:
ZDB-GENE-030710-9
Description:
glycoprotein M6Ba [Source:RefSeq peptide;Acc:NP_982251]
Human Orthologue:
GPM6B
Human Description:
glycoprotein M6B [Source:HGNC Symbol;Acc:4461]
Mouse Orthologue:
Gpm6b
Mouse Description:
glycoprotein m6b Gene [Source:MGI Symbol;Acc:MGI:107672]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa11828 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa25592
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019770 Nonsense 89 289 3 7
ENSDART00000101911 Nonsense 60 260 4 8
Genomic Location (Zv9):
Chromosome 1 (position 27909830)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 28175388
GRCz11 1 28979220
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATTTACATATTTACTAAATCTGTCTTTTTTTATATAGGGTTCAGATTTTG[C/T]AGTACATCATCTATGGAATTGCCTGTTTATTCTTCCTGTATGGCATCATC
Long Flanking Sequence:
CACTTTATATGCTTCAACACAATGACATGTATGTGGTGAGTAATGACCTCTAGAGTTCCAGCAAATACATGTCAGTATGTTCTCTTACATTGTGTCATTCTGGGCTTTACTGGAAGCAAACTGACTTGTTTTCTTTGATTTCCTGTGTACAAATTTAGTGTTAATGATCCTGTGCAGTATACACAGTACCTCAGATAAAATCCAATTGCTGTACATCTGCAGCCCTCAAAATGTAAATAATCACAGCTTCAATTATTTACTGAGCAGAAACTCAATGTCATCTAAATCCGCTACTTTTATGCTTTGGTATTGTGTTGATCTTGAATTTCATATAAACTGGTCTTTGCATGAAAAACAATCATAAATCATACAATTGGGTGAGCTCTGTTTCTCTATAAAATATTCGATAATGTAGAGGTCATAATGTTCAGCCTACTGTAGGTCTCTCATATTTACATATTTACTAAATCTGTCTTTTTTTATATAGGGTTCAGATTTTG[C/T]AGTACATCATCTATGGAATTGCCTGTTTATTCTTCCTGTATGGCATCATCTTACTGGCCGAGGGCTTTTACACCACCAGTGCTGTCAAAGAGATGCACAGTGAATTCAAGACAACTGTTTGTGGACGCTGCATCAGTGCTATGGTGAGGCCAGGAAGTATATATTTATATATATGATTCACTTCTTCACTGAGTCAGACCAAATTTATCTTGATAATGTCAAGTAACTGACAGACAAGTAAAGACTTTGATGGATGACACGTTATGACAATTTACACTATCTATAATATTTAAACTATCAATACTCTGTTGGTCCATCATGTAATCTCCTATGCCTGCTGTCAAGCAGGTTCATGCAAATCTGAGCTTCAGTATTTTCAAGACTTGCTGTTGTTTTTTTAATTCTTAAATAATAATAAAACAATTCCATTTACACAGTAGAGGCTTTGCACCACTGGAACTAGGAATGATTTTAAATGGAATACCTTTTGGGAACTAAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11828
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019770 Nonsense 192 289 4 7
ENSDART00000101911 Nonsense 163 260 5 8
Genomic Location (Zv9):
Chromosome 1 (position 27895549)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 28161107
GRCz11 1 28964939
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATTGCCAATCTCACCTCTGTGGACAACATCTGTGTTGATGTGCGGCAGTA[T/A]GGTAAACACACTRACCACCCTTTTMTGTGAATTCTTTGATGTTATTGAAA
Long Flanking Sequence:
TGAATTTCCTTAATTTTTGCAGTCCAGTAGCAGTCATTTTTGTATAAGATGTGTGTTTCTGATTGCAAAAGATGCAGATCTGATTTTTATATATATCTAAAAATGATATGTGTATGTTCAAATGAGTGACTGTCATAATCTAGTGGCAACATATGCAAGGTGATACAGCGGTAAATAGGTCATTATTCTGGGTCACATTTATACTGTATGCACTGCAGGATTTAAACGGGATCAAAGCTATGAGATTATTCACGTCATTATGAAATTAGATATATGGGTATTGAATGAATAAGTAAGCCTAAAACTGAACCTGTCTTTTTTTTTTTTTTTTAGTTTGTATTCCTCACCTATATTCTGGGCTTGGGATGGCTAGGCATCTTTGGATTTTCTGCTGTGCCTGTTTTCCTCTTTTATAACATGTGGACCACATGTGGTGCCATGAAATCCCCAATTGCCAATCTCACCTCTGTGGACAACATCTGTGTTGATGTGCGGCAGTA[T/A]GGTAAACACACTAACCACCCTTTTATGTGAATTCTTTGATGTTATTGAAAATACAGTGGTTAGGATAAATTTTTCTGGGCTTAAAAGTGTACTTTTCCTTTTATAAGTATAATTTGCTAAAAATTGTAAATGATGTTACTATTCATTTCATTCAATAACCTGTAAAGAATAAGTGTAAAGCTTAAGTAGTGCTTAGACAGATATGAGTAATACTTGTAATACTTTTCAGGTATCATCCCATGGAATGCGAACCCTGGTAAAGCCTGTGGGTCCACACTAAGCGACATCTGCAATACCAGTGAGGTAAAAAGCATTGATTCTGAAAAATAATTTTAAAAAAATCTTAAAATTATATTTTGCATATATATTTTTACAAAAACACATAACTTAGCAAACTGAGCAAAGGTATGCCAATAAATGCAGTTGTTGCTGCTATTTAGCTTGTACTGTATATCGTGATTTATGTTTACAGCAGGCTACTTGTTTATATATTGCATATA
Associated Phenotype:
Not determined