Busch Lab

ZMP

zgc:101777

Ensembl ID:
ENSDARG00000005679
ZFIN ID:
ZDB-GENE-041114-105
Description:
Cdc42-interacting protein 4 homolog [Source:UniProtKB/Swiss-Prot;Acc:Q5U3Q6]
Human Orthologue:
TRIP10
Human Description:
thyroid hormone receptor interactor 10 [Source:HGNC Symbol;Acc:12304]
Mouse Orthologue:
Trip10
Mouse Description:
thyroid hormone receptor interactor 10 Gene [Source:MGI Symbol;Acc:MGI:2146901]

Alleles

There are 6 alleles of this gene:

Allele Name Consequence Status Availability
sa33322 Nonsense Mutation detected in F1 DNA Not yet available
sa10290 Nonsense Available for shipment Available now
sa12704 Nonsense Available for shipment Available now
sa8614 Nonsense Mutation detected in F1 DNA Not yet available
sa20149 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa33322
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040855 Nonsense 35 542 2 17
ENSDART00000124215 Nonsense 35 592 2 15
Genomic Location (Zv9):
Chromosome 3 (position 55326347)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 54220163
GRCz11 3 54474826
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CACAGTCTGGCCTGGACCTGGTGGACAAATACATGAAGTTTGTAAAGGAG[C/T]GAACAGACATCGAACAGAATTATGCCAAGCAGCTAAGGTAAGATCTCCTT
Long Flanking Sequence:
TTTCAGTGGTTCATCTGTAATCATACAAAGCTTTAAGATCACTTTAATGTGCCAAAAATAAAGTTAAAATGACTTGGTTCAGAATTAATAACAGAAGTAACATTTTTGTGTGAACTAACCCTTTAATGCAAAAATGCATTCCACATGAGTATTTTTTTTTAATTTTTTATAACGGTTTTATTTGTTACCACTGGCATATTACTATTATTGGCGCAAAACATTACATTAAAATGAATCCATAAAATCGCACAGCTCTATTTTAGCCCGCAATGGAAATCAATAAAAAGAAAATGTAATGCGTGTAATTTGCAGACATTGTAAGCACAGCCAACCCACTTCAATCAAATGGATCTAGATCTGTGTCTGACAGCTTAAATTGAGTGGATTGACATTAATTTGCAGGCTTTTATTTTATCTTACAGGACCAATATGACATTCTTGATAAGCACACACAGTCTGGCCTGGACCTGGTGGACAAATACATGAAGTTTGTAAAGGAG[C/T]GAACAGACATCGAACAGAATTATGCCAAGCAGCTAAGGTAAGATCTCCTTATATATCTAGGCAATCTGGTTAGTCTCTGTGTTGGTGTTTACATGTATCTGCATGCTTCCCGTGTGTGTTTATCCAGAGCTGTGGCTGATTGTGAAATATTTGGGTCTCATGACTTGTTTGGTGGCTGAGCTGAACTTGCTGACACCTCTGAGCTCTAGCATTGGCTTCGGCCCAGAGGATAAGCGTTTCCTCGTCTGCTCCACCAATCATTCATGACCAGGCCTTGATCTCTGCCAGTTTCGAGCTTTACCTCGGTCTTCCCTCTGTCCCGCTGTGAGAGGAAGTAGGAGCAGACGAGCATATGACTAAGGGGATGTGGATGGAGAGAGTGAAAGTGGAGAACAGCTTAGCGTTCGTTTTGATTTCTCTTCTTGGGAGAAAAAGAAGGAAATAAATGCTCTGGTTTTGAGTACTTGATATTGGAAACATCTGACATTGCGATATTTTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10290
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040855 Nonsense 42 542 2 17
ENSDART00000124215 Nonsense 42 592 2 15
Genomic Location (Zv9):
Chromosome 3 (position 55326324)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 54220140
GRCz11 3 54474803
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GACAAATACATGAAGTTTGTAAAGGAGCGAACAGACATCGAACAGAATTA[T/A]GCCAAGCAGCTAAGGTAAGATCTCCTTATATNNNATSNNNTAGGCAATCTGGTTAG
Long Flanking Sequence:
TACAAAGCTTTAAGATCACTTTAATGTGCCAAAAATAAAGTTAAAATGACTTGGTTCAGAATTAATAACAGAAGTAACATTTTTGTGTGAACTAACCCTTTAATGCAAAAATGCATTCCACATGAGTATTTTTTTTTAATTTTTTATAACGGTTTTATTTGTTACCACTGGCATATTACTATTATTGGCGCAAAACATTACATTAAAATGAATCCATAAAATCGCACAGCTCTATTTTAGCCCGCAATGGAAATCAATAAAAAGAAAATGTAATGCGTGTAATTTGCAGACATTGTAAGCACAGCCAACCCACTTCAATCAAATGGATCTAGATCTGTGTCTGACAGCTTAAATTGAGTGGATTGACATTAATTTGCAGGCTTTTATTTTATCTTACAGGACCAATATGACATTCTTGATAAGCACACACAGTCTGGCCTGGACCTGGTGGACAAATACATGAAGTTTGTAAAGGAGCGAACAGACATCGAACAGAATTA[T/A]GCCAAGCAGCTAAGGTAAGATCTCCTTATATATCTAGGCAATCTGGTTAGTCTCTGTGTTGGTGTTTACATGTATCTGCATGCTTCCCGTGTGTGTTTATCCAGAGCTGTGGCTGATTGTGAAATATTTGGGTCTCATGACTTGTTTGGTGGCTGAGCTGAACTTGCTGACACCTCTGAGCTCTAGCATTGGCTTCGGCCCAGAGGATAAGCGTTTCCTCGTCTGCTCCACCAATCATTCATGACCAGGCCTTGATCTCTGCCAGTTTCGAGCTTTACCTCGGTCTTCCCTCTGTCCCGCTGTGAGAGGAAGTAGGAGCAGACGAGCATATGACTAAGGGGATGTGGATGGAGAGAGTGAAAGTGGAGAACAGCTTAGCGTTCGTTTTGATTTCTCTTCTTGGGAGAAAAAGAAGGAAATAAATGCTCTGGTTTTGAGTACTTGATATTGGAAACATCTGACATTGCGATATTTTGTTTTGCTGGAATATATATTGCAAT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3443
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040855 Nonsense 190 542 7 17
ENSDART00000124215 Nonsense 190 592 7 15
Genomic Location (Zv9):
Chromosome 3 (position 55307396)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 54201212
GRCz11 3 54455875
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CAGCAGGCGCATTTGCGAACACACATAGCAGAGGATTGTAAAAACGACTA[T/A]GCTGYACAACTTCAGAAGTACAACAAAGAGCAAAGTCAGTTCTACTTCAC
Long Flanking Sequence:
GAGTTATTTATTTGTCTGAGGAACAATGAGAATAAGAACAATGGATTTGGAACGACATGAAAGTAAACAATGGCAATCTTAATTTGTGGTTAAATGTTCCCCTTAATTGCTGCAAATGTGAGCGTTGTGTAAATAACCAACAGGAGTGTTTCTCTGATTTATGTGCTGGATGTTATTATACTTGCAGAGTAAAAAGCGATTTGAGAGGGAGTGGAGAGAAGCAGAAAAGGCTGCTCAGTATGCGGACAAAACCGATCAGGATCTCAATGCCACCAAAGCCGATGTGGAAAAGGTATTAACGTTTCACCAAAAGGTTTTGCAGGTGTCACGCACAGCTGCCGTCTCATTTCCATCATATCCAAATGCTATTGTTGTTTCCTTGTTCCTCTTTATGTACGGGTGTCTTATTTCAATTTTGCCCTTTATGTCTGCATGTAACCACAGGCCAAACAGCAGGCGCATTTGCGAACACACATAGCAGAGGATTGTAAAAACGACTA[T/A]GCTGTACAACTTCAGAAGTACAACAAAGAGCAAAGTCAGTTCTACTTCACGGACATGCCCCAGATTTTCAATGTAAGAAAATCTTGCTTCGGTCCTAACATGTTGAGACGCATCTTCTCCTATCGGATTGCTGTGGGAACCATCTTGCAGAATGCAGAGTGAATCTGAAACCTACATGTATGTTTGTTCATGACAGAAGTTGCAGGACATGGATGAAAGGCGTATTAAGAAGATGGCACAGGGCTACATCCTGTTTGCCGAAACGGAGCGTCACGTCATGCCCATCATCGGGAAATGCTTAGAGGGCATGACCAGAGCTGGCACGAATGTCAACGCGAGGAATGTGAGTCTTTTTTTAAGAAAAGCACTTCCATTTTTGGCTCTTGTTAAATCAGTAGTGTCCAATCCTTTTCCTGGTAGTTCACCAACCTGCAGAGTTCACCTCCAGTCCTAATTAAACAGACCTGAACAAGCGAATGAAGGTCTTGGGGATTACTAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12704
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040855 Nonsense 217 542 8 17
ENSDART00000124215 Nonsense 217 592 8 15
ENSDART00000040855 Nonsense 217 542 8 17
ENSDART00000124215 Nonsense 217 592 8 15
Genomic Location (Zv9):
Chromosome 3 (position 55307193)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 54201009
GRCz11 3 54455672
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGCAGAGTGAATCTGAAACCTACATGTATGTTTGTTCATGACAGAAGTTG[C/A]AGGACATGRATGAAMGGCGTATTAAGAAGATGGCACAGGGCTACATCCTG
Long Flanking Sequence:
AGAGGGAGTGGAGAGAAGCAGAAAAGGCTGCTCAGTATGCGGACAAAACCGATCAGGATCTCAATGCCACCAAAGCCGATGTGGAAAAGGTATTAACGTTTCACCAAAAGGTTTTGCAGGTGTCACGCACAGCTGCCGTCTCATTTCCATCATATCCAAATGCTATTGTTGTTTCCTTGTTCCTCTTTATGTACGGGTGTCTTATTTCAATTTTGCCCTTTATGTCTGCATGTAACCACAGGCCAAACAGCAGGCGCATTTGCGAACACACATAGCAGAGGATTGTAAAAACGACTATGCTGTACAACTTCAGAAGTACAACAAAGAGCAAAGTCAGTTCTACTTCACGGACATGCCCCAGATTTTCAATGTAAGAAAATCTTGCTTCGGTCCTAACATGTTGAGACGCATCTTCTCCTATCGGATTGCTGTGGGAACCATCTTGCAGAATGCAGAGTGAATCTGAAACCTACATGTATGTTTGTTCATGACAGAAGTTG[C/A]AGGACATGGATGAAAGGCGTATTAAGAAGATGGCACAGGGCTACATCCTGTTTGCCGAAACGGAGCGTCACGTCATGCCCATCATCGGGAAATGCTTAGAGGGCATGACCAGAGCTGGCACGAATGTCAACGCGAGGAATGTGAGTCTTTTTTTAAGAAAAGCACTTCCATTTTTGGCTCTTGTTAAATCAGTAGTGTCCAATCCTTTTCCTGGTAGTTCACCAACCTGCAGAGTTCACCTCCAGTCCTAATTAAACAGACCTGAACAAGCGAATGAAGGTCTTGGGGATTACTAGAATTACAACCTGGCAAATGTGCTTGGGCAGATTGGAGCTAAACTCAGCAGGACAGTGGGCCTTCTGGAGCAGGATTGACACCCAAGGCTTTCAGAGAGTATTTGAACCCCCTTCAAACAGAATCCGACAATATCTAACACTTTTTTTTTATGTTATTCAGGACTCTATGGTTCTCATAGAGCAACATAAGTCTGGTTTTGAGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8614
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040855 Nonsense 217 542 8 17
ENSDART00000124215 Nonsense 217 592 8 15
ENSDART00000040855 Nonsense 217 542 8 17
ENSDART00000124215 Nonsense 217 592 8 15
Genomic Location (Zv9):
Chromosome 3 (position 55307193)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 54201009
GRCz11 3 54455672
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGCAGAGTGAATCTGAAACCTACATGTATGTTTGTTCATGACAGAAGTTG[C/T]AGGACATGRATGAAMGGCGTATTAAGAAGATGGCACAGGGCTACATCCTG
Long Flanking Sequence:
AGAGGGAGTGGAGAGAAGCAGAAAAGGCTGCTCAGTATGCGGACAAAACCGATCAGGATCTCAATGCCACCAAAGCCGATGTGGAAAAGGTATTAACGTTTCACCAAAAGGTTTTGCAGGTGTCACGCACAGCTGCCGTCTCATTTCCATCATATCCAAATGCTATTGTTGTTTCCTTGTTCCTCTTTATGTACGGGTGTCTTATTTCAATTTTGCCCTTTATGTCTGCATGTAACCACAGGCCAAACAGCAGGCGCATTTGCGAACACACATAGCAGAGGATTGTAAAAACGACTATGCTGTACAACTTCAGAAGTACAACAAAGAGCAAAGTCAGTTCTACTTCACGGACATGCCCCAGATTTTCAATGTAAGAAAATCTTGCTTCGGTCCTAACATGTTGAGACGCATCTTCTCCTATCGGATTGCTGTGGGAACCATCTTGCAGAATGCAGAGTGAATCTGAAACCTACATGTATGTTTGTTCATGACAGAAGTTG[C/T]AGGACATGGATGAAAGGCGTATTAAGAAGATGGCACAGGGCTACATCCTGTTTGCCGAAACGGAGCGTCACGTCATGCCCATCATCGGGAAATGCTTAGAGGGCATGACCAGAGCTGGCACGAATGTCAACGCGAGGAATGTGAGTCTTTTTTTAAGAAAAGCACTTCCATTTTTGGCTCTTGTTAAATCAGTAGTGTCCAATCCTTTTCCTGGTAGTTCACCAACCTGCAGAGTTCACCTCCAGTCCTAATTAAACAGACCTGAACAAGCGAATGAAGGTCTTGGGGATTACTAGAATTACAACCTGGCAAATGTGCTTGGGCAGATTGGAGCTAAACTCAGCAGGACAGTGGGCCTTCTGGAGCAGGATTGACACCCAAGGCTTTCAGAGAGTATTTGAACCCCCTTCAAACAGAATCCGACAATATCTAACACTTTTTTTTTATGTTATTCAGGACTCTATGGTTCTCATAGAGCAACATAAGTCTGGTTTTGAGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20149
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040855 Essential Splice Site 368 542 13 17
ENSDART00000124215 Essential Splice Site 418 592 11 15
Genomic Location (Zv9):
Chromosome 3 (position 55292759)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 54186575
GRCz11 3 54441238
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGAAGATCGACGACATGAGCAAGGAGCTGCAGAAGGAAATGGATCAGAGG[T/C]GAGTCTTTCCTGCAGCGCTCCACCACAGGGTTCCCATGGGGTCAGGGAAT
Long Flanking Sequence:
GTAAAGCATATGAGTAAAATGCAGAAAGAAAAAAAAAACAGTGGACATATTTGAAATAACTCTCTATACTGTATGCTCATTACATATCCTTTTCAAAAACCTGGAACATTCCTTTGAGTAAACTGTTTATTTATCCCACATTTCTTCTCGACACTTCTGTCATCATAATTGAAAAACGTGTTGCCAAAATCTGAAAGCCAACAGCCTATTTATGTGGTTAAAATTACGCTGGTGGTGAAACGCTACATTACAGCTTCTTCTTCTTCAAACCTGATCTCTCACTGCTGGTCTCTGGGTCACGTCTGTCACCGATCGTGGTGTTGGAGGTCTGCCTGTGTATGTGTGTGTTTGTGAGACTCTCTGTGACAGTAGATTTGATTTCTTCTCAGCCGGTGGACACAGAAGGCTTCACTCATCTTCCTCCAGAGCAGCGTCGCAAACGCCTGCAGCAGAAGATCGACGACATGAGCAAGGAGCTGCAGAAGGAAATGGATCAGAGG[T/C]GAGTCTTTCCTGCAGCGCTCCACCACAGGGTTCCCATGGGGTCAGGGAATTTCTGGAATACCATTAAATATTAAAACGTCTATTCCAGATATTGTAAGTCAGGGGACTTCTCTGTCAAGCAATATCTGTTTTTTTTGGTTGTCATGTAAAATGTTCCTTCCCATTTATTAAAATGTTTTTTTTTTTTTTTTTGTAATTGTGTGGTTTTATTGCTTTTGTGCCATGCGCTTTAGACTTTGCGCCTAGATTGTTAAAATAGAAGCTCAAAATTTAAGAGGAGCTGCTTAACACAACAGCTTTACATTTTCCTTTTCATTATACTGTAGGTCACGGAAATTTTCTATATAGTATATAGACTATAGAATAGTCTGTAAATTTTACATTTGTCTTCGAGTGGGAACCCGGTCACCAATGCCAACTCCTTTTCAGTGAAACCGCTCTGGCGGTTTACTAAACCCTCCAGTTCTCTGAGGATCTATGGCGTTGAGTGCTACGAGTGA
Associated Phenotype:
Not determined