Busch Lab

ZMP

evx1

Ensembl ID:
ENSDARG00000005628
ZFIN ID:
ZDB-GENE-980526-364
Description:
homeobox even-skipped homolog protein 1 [Source:RefSeq peptide;Acc:NP_571324]
Human Orthologue:
EVX1
Human Description:
even-skipped homeobox 1 [Source:HGNC Symbol;Acc:3506]
Mouse Orthologue:
Evx1
Mouse Description:
even skipped homeotic gene 1 homolog Gene [Source:MGI Symbol;Acc:MGI:95461]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa36819 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa36819
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052636 Essential Splice Site 199 377 None 3
ENSDART00000141968 Essential Splice Site 74 252 None 2
ENSDART00000147608 Essential Splice Site 74 252 None 4

The following transcripts of ENSDARG00000005628 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 19185676)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 20146980
GRCz11 19 19719931
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAGATGCGAGTTGGCGGCTGCCTTAAATTTACCTGAAACCACAATAAAGG[T/A]ATTGCTTTGCAAGTCCGATTCTATTTGACATTACCGTTTTAAGTAGGCCG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4802
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052636 Nonsense 362 377 3 3
ENSDART00000141968 Nonsense 237 252 2 2
ENSDART00000147608 Nonsense 237 252 4 4

The following transcripts of ENSDARG00000005628 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 19184860)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 20146164
GRCz11 19 19719115
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GACCAGGACTGAGGCCTTCCTCACTTTCTCGCCAGCAGTCATCAGCAAAT[C/A]ATCTTCGGTGTCTTTGGACCAGAGGGAGGAAGTGCCACTAACTAGATAAG
Associated Phenotype:
Not determined