Busch Lab

ZMP

bmpr1ba

Ensembl ID:
ENSDARG00000005600
ZFIN ID:
ZDB-GENE-991208-8
Description:
bone morphogenetic protein receptor type-1B [Source:RefSeq peptide;Acc:NP_571532]
Human Orthologue:
BMPR1B
Human Description:
bone morphogenetic protein receptor, type IB [Source:HGNC Symbol;Acc:1077]
Mouse Orthologue:
Bmpr1b
Mouse Description:
bone morphogenetic protein receptor, type 1B Gene [Source:MGI Symbol;Acc:MGI:107191]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa13912 Nonsense Available for shipment Available now
sa33531 Nonsense Mutation detected in F1 DNA Not yet available
sa20343 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa13912
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027129 Nonsense 120 504 4 10
Genomic Location (Zv9):
Chromosome 5 (position 8836830)
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GTGTGTGTGTGTGTGTGYGTGCGTGCGNNNNNNNNCGNNTGCGTGCAGGTTA[T/A]GTGGTTGGAGACATTCATCATATCGCTCTGCTCATCTCWGTGAGCGTCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33531
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027129 Nonsense 250 504 6 10
Genomic Location (Zv9):
Chromosome 5 (position 8834194)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 7013278
GRCz11 5 7504433
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTGTTTTTCACCACAGAGGAGGCCAGCTGGTTCAGGGAGACCGAGATCTA[T/A]CAGACCGTCCTCATGAGACATGACAATATACTGGGTGAGCATAACACACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20343
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027129 Nonsense 425 504 9 10
Genomic Location (Zv9):
Chromosome 5 (position 8824634)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 7003718
GRCz11 5 7494873
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTCTGAAGTGAGATGTTGTGTGTTGTTTGTGCAGGTATAGTAGAGGAGTA[T/A]CAGCTGCCGTATCATGATCATGTTCCCAATGACCCGTCATATGAAGACAT
Associated Phenotype:
Not determined