Busch Lab

ZMP

si:dkey-170m15.2

Ensembl ID:
ENSDARG00000005595
ZFIN ID:
ZDB-GENE-041001-205
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:Q5RH17]
Human Orthologue:
C6orf103
Human Description:
chromosome 6 open reading frame 103 [Source:HGNC Symbol;Acc:21212]
Mouse Orthologue:
9130014G24Rik
Mouse Description:
RIKEN cDNA 9130014G24 gene Gene [Source:MGI Symbol;Acc:MGI:3605549]

Alleles

There are 7 alleles of this gene:

Allele Name Consequence Status Availability
sa37074 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa37073 Nonsense Mutation detected in F1 DNA Not yet available
sa10146 Essential Splice Site Available for shipment Available now
sa18046 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa7937
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021575 Essential Splice Site 101 1471 3 35
ENSDART00000133556 Essential Splice Site 63 225 2 6
ENSDART00000135492 None None 716 None 17
ENSDART00000141636 None None 103 None 3
Genomic Location (Zv9):
Chromosome 20 (position 32042896)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 32101136
GRCz11 20 32004015
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CCTTGAGGATACACACTTGGAAACGACCTTCAGAGTTCATACTTAAAAAG[G/A]TAAGAGTTAAGTCCAACGCAGCAGGTCCAACAAACTCCATTAACCTAAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37074
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021575 Essential Splice Site 345 1471 None 35
ENSDART00000133556 None None 225 None 6
ENSDART00000135492 None None 716 None 17
ENSDART00000141636 Essential Splice Site 22 103 None 3
Genomic Location (Zv9):
Chromosome 20 (position 32022665)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 32080905
GRCz11 20 31983784
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCAGCCCTTGCACCTAATGGAGAAAAGAACCTCAATGCTCACGAGGATGG[T/A]AAGCATATGAGTTTTAATCTGCAAGTCTGCACATAAACTACTGTTTAAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37073
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021575 Nonsense 371 1471 10 35
ENSDART00000133556 None None 225 None 6
ENSDART00000135492 None None 716 None 17
ENSDART00000141636 Nonsense 48 103 2 3
Genomic Location (Zv9):
Chromosome 20 (position 32020582)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 32078822
GRCz11 20 31981701
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGTATGGGCTATCTCAGCTCTTCAGTCACCCAGTGCTTCTCACCTGCACT[C/T]GAGACTGTCCTCTAGTGGCCCCTCCTAAAACACCTCCACTGCCTCAATGG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4915
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021575 Nonsense 443 1471 12 35
ENSDART00000133556 None None 225 None 6
ENSDART00000135492 None None 716 None 17
ENSDART00000141636 None None 103 None 3
Genomic Location (Zv9):
Chromosome 20 (position 32016435)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 32074675
GRCz11 20 31977554
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GTGTGTATGTGTGTTTTTAGGGAGCATGGAGGTTTAAAGAAGCGCATGTA[T/G]AATTCTAATCTGACTTCATTTTCTGAAATGGAAGATACTGAAGATGAACA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29390
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021575 Nonsense 846 1471 22 35
ENSDART00000133556 None None 225 None 6
ENSDART00000135492 Nonsense 334 716 9 17
ENSDART00000141636 None None 103 None 3
Genomic Location (Zv9):
Chromosome 20 (position 31993024)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 32051264
GRCz11 20 31954143
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATGAGACTCCAGAGGGCTGGACTGGCAGGCAGGCCACAGACAAGGAAATG[C/T]AGGCAGCAATAGTCCTGCAGGCCGGATGGAAGGGATACCTAGTTAGAGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10146
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021575 Essential Splice Site 1192 1471 None 35
ENSDART00000133556 None None 225 None 6
ENSDART00000135492 Essential Splice Site 680 716 None 17
ENSDART00000141636 None None 103 None 3
Genomic Location (Zv9):
Chromosome 20 (position 31975018)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 32033258
GRCz11 20 31936137
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGAGTATTTTGTGAATTTGTATAATTTTGATTGTTCTGTTTGACATTGAC[A/G]GTGTTTGGAGATATTYTGGATGGCACATCTATGCCTGTGGGTACAGACCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18046
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021575 Nonsense 1211 1471 30 35
ENSDART00000133556 None None 225 None 6
ENSDART00000135492 Nonsense 699 716 17 17
ENSDART00000141636 None None 103 None 3
Genomic Location (Zv9):
Chromosome 20 (position 31974960)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 32033200
GRCz11 20 31936079
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GAGATATTYTGGATGGCACATCTATGCCTGTGGGTACAGACCAACAAAAC[A/T]GAGAGGGYCAKAAATCTACTCCCAAATCAACCCACAAGGCCAAGGAAAAA
Associated Phenotype:
Not determined