Busch Lab

ZMP

entpd8

Ensembl ID:
ENSDARG00000005565
ZFIN ID:
ZDB-GENE-040724-142
Description:
ectonucleoside triphosphate diphosphohydrolase-like [Source:RefSeq peptide;Acc:NP_001002379]
Human Orthologue:
ENTPD8
Human Description:
ectonucleoside triphosphate diphosphohydrolase 8 [Source:HGNC Symbol;Acc:24860]
Mouse Orthologue:
Entpd8
Mouse Description:
ectonucleoside triphosphate diphosphohydrolase 8 Gene [Source:MGI Symbol;Acc:MGI:1919340]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa40767 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa33927 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa40767
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011245 Essential Splice Site None 496 1 10
ENSDART00000122819 None None 496 None 9
ENSDART00000125659 None None 455 None 8
Genomic Location (Zv9):
Chromosome 6 (position 40970118)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 41041718
GRCz11 6 41039254
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTGGCTTCAATATACGGGATATACTTTGTTCATAAAGAAAGGAAAAAAGG[T/A]AAGACACTTTTGTTTCAAGGTGTGAAATCTGGTTTGAACAACAAACATCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33927
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011245 Essential Splice Site 185 496 6 10
ENSDART00000122819 Essential Splice Site 185 496 5 9
ENSDART00000125659 Essential Splice Site 144 455 4 8
Genomic Location (Zv9):
Chromosome 6 (position 40983043)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 41054643
GRCz11 6 41052179
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAGTGATTTCTCACAAAATGTTCACCACACCTTTAATGGCTTTTTCCTGT[A/G]GCACACATTTGAGGGCTCCTGGATCCACCCTAAAGCCGGAAAGATCATTG
Associated Phenotype:
Not determined