Busch Lab

ZMP

xpo7

Ensembl ID:
ENSDARG00000005540
ZFIN ID:
ZDB-GENE-060628-2
Description:
exportin-7 [Source:RefSeq peptide;Acc:NP_001121702]
Human Orthologue:
XPO7
Human Description:
exportin 7 [Source:HGNC Symbol;Acc:14108]
Mouse Orthologue:
Xpo7
Mouse Description:
exportin 7 Gene [Source:MGI Symbol;Acc:MGI:1929705]

Alleles

There are 6 alleles of this gene:

Allele Name Consequence Status Availability
sa9320 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa34881 Nonsense Mutation detected in F1 DNA Not yet available
sa9930 Nonsense Available for shipment Available now
sa16794 Nonsense Available for shipment Available now
sa38791 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa9320
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027612 Essential Splice Site 6 1087 None 28
ENSDART00000145264 Essential Splice Site 6 1090 None 28
Genomic Location (Zv9):
Chromosome 10 (position 20104149)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 20112835
GRCz11 10 20070216
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GGGGGAGTGAGAGGAGCATGAATGGAGCAAAATGGCGGATCATGTGCAGG[T/C]AAGTAAATTATTTTGTTTTGCTATTATGAAATKAATGAATTTTGATYCAC
Long Flanking Sequence:
AACTAATTCCATTAAATGCAGAATTTTGAAACAGTGAACATAACATTTTTACATTCAGGGTCACTGTACACATTTTTTTGACATCAAACAAGTGATGCACATTGTTTTGTGTAAAATTAGTCAGCACGTTTTTTTACTTTTACAACAGGTGCAAACATTCACCGCGTGAACACTCACAAAACATTTTCATCAGTTAATAGCCTTGATTCTCAACTTGCAAAGTTTAATCACGCTTGAAATTATAAATCCACGTGACAGCTAATATTTGAATTCGCAGTTTCACTTTAAGAAGCATGTAAACAAAGGCTCTTTTCGGCGTTATTTCGGCGGTGGACGTCCATCGTAACGGTATTCACGAAGCCTCGAGCGAACATCTGGCTTGATCAGTGCGTACGTCAATTGCGTAAATGTTCCAGTGATTGTGTGCAGATGCGCGCATGCTCATTGTCAGGGGGAGTGAGAGGAGCATGAATGGAGCAAAATGGCGGATCATGTGCAGG[T/C]AAGTAAATTATTTTGTTTTGCTATTATGAAATGAATGAATTTTGATCCACTGCAGTCTAATGGTAAATGTCGAGACTTATTTCGGCGATGCGTGCGTGTTTGTTTTAAATGCATGCTTCGCCAAACGAGAGAGCTTGACTAGCATGCTTTATTGGATGCGATTATCAAGTGTTGACTTGTGGCCTGTCATCATGTTGATTTTAACTCTGTGGTCCAAGCTAACACACAACTCTGTCGCATAAGTGAAAGTTGTTTTGAAGCAAGATGCGAAGACTATCGGTTTAAGCAGCAGGAATTGGCAGATACAGAGAGATTGTTTATTTCCCCCCCTGCACGTAACTCTATAGCGACAGTCATGTTTTACATTGTAAACAAGGCATCATCTTCATCCAAACCCTTGCTGTGCAATAACTACACACTGGCCTTATATCCACAATGCGATAGTGACTCGAAATAAGCGAGTCTTTTTTCCGAGTGAAAAGACTGCTGTTAAGCCTAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34881
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027612 Nonsense 10 1087 2 28
ENSDART00000145264 Nonsense 10 1090 2 28
Genomic Location (Zv9):
Chromosome 10 (position 20108854)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 20117540
GRCz11 10 20074921
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATTTAAATAGCAATGACTTTTTATTGTTTTTGTTCTTTCAGAGCCTAGCC[C/T]AGCTAGAGATCCTGTGCAAGCAGCTGTATGAGACCACAGACACCACCACA
Long Flanking Sequence:
CATAAACGTGATGTTCAATGTTGTGATTGTACAAGAAGATACAGAAGCTTTGCTGAAGTAATATTATTTGGCTTAGGGTACAACCTTAGCTTTGACGTAGCTGTTATGTCCAGGTTTGTTGAGGTAGTGTACTGTTACAGTTTCATAAGTGTTCTCAAATTTCAACTTAATCACAAGTTGTAAATGCAGCACTATCATGGTAAGTTTTTTTTTTTTTTTGACACATTCCCTCATTTATGAGAAGTGCATATGGTTTTAAAAAATAAAAATATATCAATCATAGTTATATGAATAATGATAATTTTGGGTCAAAAGTAAACCAAAATGTGAAATTTGATTACAGATGGTTAAGAAATTATCTACCAAAATACATCCTTTGAATGTTGTTTTAATGAAGTCAAAACATATTTGTATTTCTAATATAAAAAATAATGTGATGGCAACAAAGACATTTAAATAGCAATGACTTTTTATTGTTTTTGTTCTTTCAGAGCCTAGCC[C/T]AGCTAGAGATCCTGTGCAAGCAGCTGTATGAGACCACAGACACCACCACACGTCTTCAGGCCGAGAAAGCACTGGTGGAGTTCACCAACAGTCCTGACTGCCTGAGTAAATGCCAGTTGTTGCTGGAAAGAGGAAGTGTAAGACTTTAACTTTCTGAAAACTGTAGAACACAATCTCTCAAATGATCTAACCTCAACTATTTTTTCAAAAACTCCATTCTTCCCACATTATTTTGAGTTGAGTAAGTCTTTTCTGAATTGCGAACTGTGTTTTTGTTTGTTTGTTTGTTTTTCCAGTCCTCGTACTCACAGTTGTTGGCTGCGACGTGTCTCTCCAAGTTGGTGTCACGAACAAGTAACCCCCTTCCTCTGGAGCAGCGCATTGACATTCGTAAGTTTATAGAATCCGCCACAAATTCAACTTTAAAATTAGATCCCAATTTTTGAAATTGTCTAATTGATTCCTCAGGAAATTATGTTCTCAATTATCTGGCAACCCGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9930
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027612 Nonsense 73 1087 3 28
ENSDART00000145264 Nonsense 73 1090 3 28
Genomic Location (Zv9):
Chromosome 10 (position 20109202)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 20117888
GRCz11 10 20075269
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CCTCGTACTCACAGTTGTTGGCTGCGAYGTGTCTCTCCAAGTTGGTGTCA[C/T]GAACWAGTAACCCCCTTCCTCTGGAGCAGCGCATTGAYATTCGTAAGTTT
Long Flanking Sequence:
TAAGAAATTATCTACCAAAATACATCCTTTGAATGTTGTTTTAATGAAGTCAAAACATATTTGTATTTCTAATATAAAAAATAATGTGATGGCAACAAAGACATTTAAATAGCAATGACTTTTTATTGTTTTTGTTCTTTCAGAGCCTAGCCCAGCTAGAGATCCTGTGCAAGCAGCTGTATGAGACCACAGACACCACCACACGTCTTCAGGCCGAGAAAGCACTGGTGGAGTTCACCAACAGTCCTGACTGCCTGAGTAAATGCCAGTTGTTGCTGGAAAGAGGAAGTGTAAGACTTTAACTTTCTGAAAACTGTAGAACACAATCTCTCAAATGATCTAACCTCAACTATTTTTTCAAAAACTCCATTCTTCCCACATTATTTTGAGTTGAGTAAGTCTTTTCTGAATTGCGAACTGTGTTTTTGTTTGTTTGTTTGTTTTTCCAGTCCTCGTACTCACAGTTGTTGGCTGCGACGTGTCTCTCCAAGTTGGTGTCA[C/T]GAACAAGTAACCCCCTTCCTCTGGAGCAGCGCATTGACATTCGTAAGTTTATAGAATCCGCCACAAATTCAACTTTAAAATTAGATCCCAATTTTTGAAATTGTCTAATTGATTCCTCAGGAAATTATGTTCTCAATTATCTGGCAACCCGGCCAAAGCTTGCTGCCTTCGTGACACAAGCCCTGATCCAGCTCTATGCCAGAATCACCAAACTCGGCTGGTTCGACTGCCAAAAGGAAGATTACGTCTTCAGGAATGTCATAGTTGATGTGACAAGATTTCTGCAGGTATGATTGATTATGAAAGTCTTTTGGTGAAGATAATATTCTTCATTTCAGAATTATACAATGGATGACAATTCAAATGCAATTTGGTTTCTTTTCGAGTGTTCATTCTTGTTAGATGTGAAGTGTTTGTCATCCAGACTAAAACAATTAGTCATGTTTTATTTGTCACTTGAATGAATTGCAGTTGAATCACAATTAATCACATGCACTCAC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27590
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027612 Nonsense 430 1087 12 28
ENSDART00000145264 Nonsense 433 1090 12 28
Genomic Location (Zv9):
Chromosome 10 (position 20117723)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 20126409
GRCz11 10 20083790
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATTTTCCTAGTATTCCTAAATGCAATTTCCATTGATGTAGGGACGGTCTT[G/T]AAGATCCCTTGGACGATGCTGGACTGGTGCAACAGCAGCTGGACCAGCTG
Long Flanking Sequence:
TATTTATTAATTAATTGTCAATAATTATTTCTATCTACACATTATTAATGGTCAGAATTCATAGGCTTATTTATATGCATAGTTTAGGAGTGAATGTGACAGACACATTTAGCATATGCAGGTGTAAGTTAAAAGGTTGATTCACCCAAAAATATAAATTTTGTTATTAAATATTAACCGTCATGTTGTTTTAACCCCTGAGACCTTTGTTTATTCTTGGAAAAAATGAAGAAATTTTAGATGAAATCTGAGAGCTCTCTCATTCTCCAAAGATGGTGTTTCCAAGATATTTCAATTCCAGAAAAGGAACCAAACTATTATTCCATGTCACTTTAGTGGTTTAAGTGTAATCATAATAAGCTCCCACACCTTTTTTTATATTGCTCTTAGTAAATGTGCACACTGATGAGGAAGAAAGAGATCCACCATTGGAATCATTTTAATAAATTGATTTTCCTAGTATTCCTAAATGCAATTTCCATTGATGTAGGGACGGTCTT[G/T]AAGATCCCTTGGACGATGCTGGACTGGTGCAACAGCAGCTGGACCAGCTGTCTACTATTGGCCGGTGTGAGTACGAGAAGACCTGTGCGCTGCTGGTCCAGCTCTTCGATCAGTCGGCTCAGTCATACCAGGAGCTGCTGCAGTCCACTAACTCCAGCACAATGGACATCGCAGTTCAGGAAGGTAAGCTCAACACATCTTGTCTTTCTTGATTCACAATTGTGACACAACATTTATGTGATGTGTGTGTGTTTTTCAGGACGTTTGACATGGCTAGTGTACATCATTGGTGCAGTCATTGGTGGAAGAGTATCGTTCGCCAGCACGGATGAGCAGGATGCCATGGATGGAGAGCTTGTGTGTCGGTGAGGAACTTTAAAAAGTTCAGACCAGGATGTATGCTTGGCATAAACGTATTCTCCACTTTTATATATACAAATTATTTATTGGGCTCATACAACGTGATAAATGCAACAGAATATACTGGCTTTTTAATCAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16794
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027612 Nonsense 787 1087 22 28
ENSDART00000145264 Nonsense 790 1090 22 28
Genomic Location (Zv9):
Chromosome 10 (position 20123680)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 20132366
GRCz11 10 20089747
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGTGATYTCWGACTCACTGAATGWGTTTTTCATGAAGGTCACAGAGATTA[C/T]AGTTYGATGTGTCGTCGCCGAATGGAATCCTGCTGTTYAGGGAGACCAGC
Long Flanking Sequence:
TAATTTTATTGTTATTGCTGTTTAATTTGTATATATATATATATATATATATATATATATATATATATATATATATATATATATATATACAGATAAACAGATAGATGGATAGCTATATTTGCGCACTTTAACTGTTAAATAATTCTTTTAAATTAATTTTTAAAAATGTAAATGTAATAAATTAATAAAAAGTACATTATTTAAAATCTTTGCTTAATATATTGCTAATTAGAAGCAATATGGGGAAATAAATTCAGTTCAGTTGTGCTTCTTAACAGATTTTTAGATACCCTTCTTACATGCCCATCTTGCAGAGGGCAATAGAGCTGTGGTACCACGTGCCCGCCTGCACCACACCGGTCCTCAAACTCATGGCTGAGCTCGTCCACAACAGGTACGCTAATGTTACATGTCACAAATGTCGTTGAGAGCTGTGTTTTAAATGTTATGTGTGATCTCTGACTCACTGAATGTGTTTTTCATGAAGGTCACAGAGATTA[C/T]AGTTCGATGTGTCGTCGCCGAATGGAATCCTGCTGTTCAGGGAGACCAGCAAGATGATTACAACTTACGGTACATCCTTATTAATTACCCAATGCAGGGCTCGAAATTGCGACCATTTTAGTTGCATGTGCGCCGAAATTTTATCTAAGTGACCTCAAAACATAATTGGGAGCATTTGTGCAAGTGCATAAAATTAATGTCATGCGACCAGTTTTCATAGCAAAATGTTCACCACATGTGTGGAATTAGGAGGCATTCACGCATTAAGCATCTTTGCACCTAAAAACACCAAACGCAGCGCTCAGGAATGATTTAAAATAGTTGACATGTCAACTTGCTGTAGTAAACAAAGCCCGCAATGCTTGCACTGCCTTAAAGCTCTTCTTATTGGCCCGCTGTGCTAGAACAGAAAATGAATGGATTGGTTAATATCAGCTGTCAATCACTCAGTTCCCATGACCGGGAGCTACAGGTCTGGCAATGAGAGAATGAAAACAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38791
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027612 Nonsense 1078 1087 28 28
ENSDART00000145264 Nonsense 1081 1090 28 28
Genomic Location (Zv9):
Chromosome 10 (position 20133388)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 20142074
GRCz11 10 20099455
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTTTCAGTATTTAGAAGAGAAGTCAATGACTCCATGAAGAATTCCACATA[C/A]GGGGTAAACAGCAACGACATGATGAGCTGACATTCCATAGAGCACCAGGC
Long Flanking Sequence:
GAATGAAGACAAAACTAAACCAGTTGAATATGACTTTTACATATACATGACTGAAAACTGAATATGATCAATGTGTTACATCTGTTCTTTGATACTTGCTGACTGCTTGTAAATTCAAAACCGAATTTCCTAATGTAAAACTATGTACACTAAATTTCTGATTAATATTAGCCTCTGCATAATCCTACATTACAAGTTTTAACAACCCCCCAGAACGGCCTTTTGTTGGCTTGATGTACATCACATAACATATCTTTACTAAACTCAAACTAAGATTTTACAAGCAGTACTAGCATTTATTAAATAAACCTAACAGGCATCTGCCAATATACTCACCAATTGTTTTTTTTTATTTTCATTTGCCCCTTAGTGAGTGATAATTTTAGCACGTTTATAACTTCATCCTCAAACTCATTTTTTCTGTCTCTCTTTCACAGGTTTACACAGAATCTTTCAGTATTTAGAAGAGAAGTCAATGACTCCATGAAGAATTCCACATA[C/A]GGGGTAAACAGCAACGACATGATGAGCTGACATTCCATAGAGCACCAGGCTCCGCCCGTGTGGCCCGGCCCCTCCCTCAACTCCCACCCGCCCCCAGCCCGGCTGCTGGGGGAGCACCGCTGCGCAAGCCTGCACCTCCCGCTCCCCAGTCCCTAAAAACCCCATTACCTCTCTCCCCTCACACCTCCCCATCCCTTTTTTATATATATATATATATAAATATATATATACACATATAAATATATACATATTTTAAAGCCAGTTTCTAGAGGTCATTCTCCTTGACCATTCTCTTGTCATTTGGGGCTTGAAGTCCAAAGAGAGAGAATAGGGTACGGCTGGGGAATGGGTTTGGGGTGTGGGACCGCACCAGTGTGGACTCTATAGAATGGGCAACACACCCAAACCGCTCCGAGGGACGAAGTGGGCGCCTGTGTTTGTATGTGAGTGTGTGTGTGAGAGTGCAAGTGTGTTTGAGAGCATGTCTGTGGGAGGAAGGG
Associated Phenotype:
Not determined