Busch Lab

ZMP

slc5a9

Ensembl ID:
ENSDARG00000005518
ZFIN ID:
ZDB-GENE-080513-3
Description:
Sodium/glucose cotransporter 4 [Source:UniProtKB/Swiss-Prot;Acc:A8WHP3]
Human Orthologue:
SLC5A9
Human Description:
solute carrier family 5 (sodium/glucose cotransporter), member 9 [Source:HGNC Symbol;Acc:22146]
Mouse Orthologue:
Slc5a9
Mouse Description:
solute carrier family 5 (sodium/glucose cotransporter), member 9 Gene [Source:MGI Symbol;Acc:MGI:214

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa27155 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa34356 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa18368 Splice Site, Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa27155
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024433 Essential Splice Site 103 657 3 13
ENSDART00000141185 Essential Splice Site 90 116 3 5
Genomic Location (Zv9):
Chromosome 8 (position 15773297)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 15218641
GRCz11 8 15256346
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTGGGACAGGAGCCGCTGGGGGACTCGCCGTCGGGGGATTTGAGTGGAAT[G/A]TATGACACACAACTCAATCCTCATCCTAAAAGCTTTGTGTTGTTTCAGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34356
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024433 None None 657 None 13
ENSDART00000141185 Essential Splice Site None 116 4 5
Genomic Location (Zv9):
Chromosome 8 (position 15773620)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 15218964
GRCz11 8 15256669
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCTGTCTCTCATCCTCTACATTTTAACCAAGATATCAGTAAGATCTTTGG[G/A]TAAACAGATAAAAAAAGAAGACAAACATTGGTGGTGGTTTGAGGAAATCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18368
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024433 Splice Site, Nonsense 477 657 11 13
ENSDART00000141185 None None 116 None 5
Genomic Location (Zv9):
Chromosome 8 (position 15781208)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 15226552
GRCz11 8 15264257
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CCATCACCACAGTRTTCATTATGGCCATATTTTGGGGGAGAGTAAATGAA[C/T]AGGTGATTTAATATCCTTAAWGTRRAAGGCTTTTACGTGAGAAAATTGTA
Associated Phenotype:
Not determined