Busch Lab

ZMP

gdf6b

Ensembl ID:
ENSDARG00000005510
ZFIN ID:
ZDB-GENE-980526-442
Description:
Growth/differentiation factor 6-B [Source:UniProtKB/Swiss-Prot;Acc:A8E7N9]
Human Orthologue:
GDF6
Human Description:
growth differentiation factor 6 [Source:HGNC Symbol;Acc:4221]
Mouse Orthologue:
Gdf6
Mouse Description:
growth differentiation factor 6 Gene [Source:MGI Symbol;Acc:MGI:95689]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa43280 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa36836 Nonsense Mutation detected in F1 DNA Not yet available
sa23521 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa43280
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022193 Essential Splice Site 117 412 2 2
Genomic Location (Zv9):
Chromosome 19 (position 23488080)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 23417495
GRCz11 19 23001818
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTTGTGGATGCAGATCTAGTGTCAACAAGCATCTGTTCTCTTTGTTTCA[G/T]ATGACCATTTGAACTCTCCACTTTGGAGACAGAAATATTTATTCGACGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36836
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022193 Nonsense 120 412 2 2
Genomic Location (Zv9):
Chromosome 19 (position 23488090)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 23417505
GRCz11 19 23001828
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCAGATCTAGTGTCAACAAGCATCTGTTCTCTTTGTTTCAGATGACCATT[T/A]GAACTCTCCACTTTGGAGACAGAAATATTTATTCGACGTATCAACGCTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23521
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022193 Nonsense 127 412 2 2
Genomic Location (Zv9):
Chromosome 19 (position 23488110)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 23417525
GRCz11 19 23001848
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CATCTGTTCTCTTTGTTTCAGATGACCATTTGAACTCTCCACTTTGGAGA[C/T]AGAAATATTTATTCGACGTATCAACGCTTTCTGAAAATGTGGAGATCCTG
Associated Phenotype:
Not determined