Busch Lab

ZMP

odz3

Ensembl ID:
ENSDARG00000005479
ZFIN ID:
ZDB-GENE-990714-19
Description:
Teneurin-3 [Source:UniProtKB/Swiss-Prot;Acc:Q9W7R4]
Human Orthologue:
ODZ3
Human Description:
odz, odd Oz/ten-m homolog 3 (Drosophila) [Source:HGNC Symbol;Acc:29944]
Mouse Orthologue:
Odz3
Mouse Description:
odd Oz/ten-m homolog 3 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1345183]

Alleles

There are 10 alleles of this gene:

Allele Name Consequence Status Availability
sa7384 Missense Mutation detected in F1 DNA Not yet available
sa5941 Nonsense Mutation detected in F1 DNA Not yet available
sa19536 Nonsense Available for shipment Available now
sa32721 Nonsense Mutation detected in F1 DNA Not yet available
sa24853 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa1982 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa7384
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Missense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005592 None None 2590 None 26
ENSDART00000122700 Missense 76 2778 1 30
ENSDART00000137676 None None 2590 None 27

The following transcripts of ENSDARG00000005479 do not overlap with this mutation:

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 39845341)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 38764740
GRCz11 1 39482813
KASP Assay ID:
554-4292.1 (used for ordering genotyping assays)
KASP Sequence:
ACGGAGGCCACGTCAAAGAGATGGTCCACCGAGAGGCAGACGARTATAGC[C/T]GCCARGKTGAGTCGCCCATGACTTCACCCMGTCCACAGGTCACATGACAC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4857
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005592 None None 2590 None 26
ENSDART00000122700 Essential Splice Site 77 2778 1 30
ENSDART00000137676 None None 2590 None 27

The following transcripts of ENSDARG00000005479 do not overlap with this mutation:

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 39845348)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 38764747
GRCz11 1 39482820
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CCACGTCAAAGAGATGGTCCACCGAGAGGCAGACGARTATAGCCGCCARG[G/T]TGAGTCGCCCATGACTTCACCCMGTCCACAGGTCACATGACACAAACTGG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa5659
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005592 Essential Splice Site 333 2590 6 26
ENSDART00000122700 Essential Splice Site 506 2778 8 30
ENSDART00000137676 Essential Splice Site 333 2590 7 27

The following transcripts of ENSDARG00000005479 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 40046996)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 38966395
GRCz11 1 39684468
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGTGATTAGAATGGGATTTGATTTGTTTTGTGTGTGTGTTTTTGTGTACA[G/A]TATGACTTTGTGGAGCTGCTGGATGGCAGTCGTCTGATAGCAAAAGAGAA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa25630
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005592 Essential Splice Site 437 2590 None 26
ENSDART00000122700 Essential Splice Site 610 2778 None 30
ENSDART00000137676 Essential Splice Site 437 2590 None 27

The following transcripts of ENSDARG00000005479 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 40057093)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 38976492
GRCz11 1 39694565
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGTACATGCCATTGTTTCCCAGGGTTCCTTGGGCCTGATTGCTCGCGAGG[T/G]ATGCTCTCTTACACACACACACACACACACACACACACACACACACACAC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa5660
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005592 Essential Splice Site 501 2590 8 26
ENSDART00000122700 Essential Splice Site 674 2778 10 30
ENSDART00000137676 Essential Splice Site 501 2590 9 27

The following transcripts of ENSDARG00000005479 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 40059584)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 38978983
GRCz11 1 39697056
KASP Assay ID:
554-3606.1 (used for ordering genotyping assays)
KASP Sequence:
GGGCACCTGCGCCTGCAACACAGGCTATAAAGGAGACAACTGCGAAGAAG[G/A]TCAGAGACGCAAATCAAAACTGAGCCAGTTTATATGAATAMCATTCTATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5941
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005592 Nonsense 779 2590 13 26
ENSDART00000122700 Nonsense 967 2778 17 30
ENSDART00000137676 Nonsense 779 2590 14 27

The following transcripts of ENSDARG00000005479 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 40095104)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 39014503
GRCz11 1 39732576
KASP Assay ID:
554-3838.1 (used for ordering genotyping assays)
KASP Sequence:
ACTGCAGATGGCACACCTYTGATTGGAGTCAACGTGTCCTTTGTGCACTA[T/A]CCAGACCACGGATACACCATCACACGACAGGACGGCATGTAGGTTGAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19536
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005592 Nonsense 951 2590 15 26
ENSDART00000122700 Nonsense 1139 2778 19 30
ENSDART00000137676 Nonsense 951 2590 16 27

The following transcripts of ENSDARG00000005479 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 40101822)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 39021221
GRCz11 1 39739294
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTTTCAGAAGTGGTTCCCTGCAGAACCCAACCTGTCATACACCTTCATCT[G/A]GGACAAAACAGACGCATACAACCAAAGAGTCTACGGCCTGTCCGAGGCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32721
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005592 Nonsense 1032 2590 17 26
ENSDART00000122700 Nonsense 1220 2778 21 30
ENSDART00000137676 Nonsense 1032 2590 18 27

The following transcripts of ENSDARG00000005479 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 40118140)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 39037539
GRCz11 1 39755612
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGGCAGGCATCCTGTACAAAGGCAACGGTGAGAACGTCTTCGTCTCTCAG[C/T]AGCCTCCAGTGATCAGCACTATTATGGGGAATGGGCGCAGGCGCAGTATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24853
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005592 Essential Splice Site 1229 2590 19 26
ENSDART00000122700 Essential Splice Site 1417 2778 23 30
ENSDART00000137676 Essential Splice Site 1229 2590 20 27

The following transcripts of ENSDARG00000005479 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 40127101)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 39046500
GRCz11 1 39764573
KASP Assay ID:
554-7391.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCACATCTGCTCGCCCACTGACCTGTGATAACAGCATGCATATTGGACAG[G/A]TATATATATATATATATATATCCATACTCACTTGTTCATACTATTGCTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1982
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005592 Nonsense 1431 2590 20 26
ENSDART00000122700 Nonsense 1619 2778 24 30
ENSDART00000137676 Nonsense 1431 2590 21 27

The following transcripts of ENSDARG00000005479 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 40130386)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 39049785
GRCz11 1 39767858
KASP Assay ID:
554-2801.1 (used for ordering genotyping assays)
KASP Sequence:
GACTCTAATGGAACTCACCAGTATACTATGAGCTTGGTCACTGGTGATTA[T/A]AAGTACAACTTCAGCTATAGCAATGAGGACGATGTCACCGCTGTAACAGA
Associated Phenotype:
Not determined