Busch Lab

ZMP

kif5a

Ensembl ID:
ENSDARG00000005470
ZFIN ID:
ZDB-GENE-070912-141
Description:
LOC553428 protein [Source:UniProtKB/TrEMBL;Acc:Q504B9]
Human Orthologue:
KIF5A
Human Description:
kinesin family member 5A [Source:HGNC Symbol;Acc:6323]
Mouse Orthologue:
Kif5a
Mouse Description:
kinesin family member 5A Gene [Source:MGI Symbol;Acc:MGI:109564]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa10562 Nonsense Available for shipment Available now
sa27306 Nonsense Mutation detected in F1 DNA Not yet available
sa7168 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27305
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044227 Essential Splice Site 167 349 6 11
ENSDART00000110704 Essential Splice Site 167 1033 6 29
Genomic Location (Zv9):
Chromosome 9 (position 196203)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 288307
GRCz11 9 287940
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GACCAACCTGTCTGTGCATGAGGACAAGAACCGCGTCCCGTACGTGAAGG[T/A]GAGCGTGACACCTGCAGCTTCATTACTGTGGGGACTGACTGAAGAGTTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10562
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044227 None None 349 None 11
ENSDART00000110704 Nonsense 361 1033 11 29
Genomic Location (Zv9):
Chromosome 9 (position 200668)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 283842
GRCz11 9 283475
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GGAAATACGAGAAGGAGAAGGAGAAGAACAAGAGTCTGCGGGACTCCATG[C/T]AGAGGCTGGAGCTGGAGCTGCGGCGCTGGCGCAACGGTAATCACAGTCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa27306
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044227 None None 349 None 11
ENSDART00000110704 Nonsense 820 1033 22 29
Genomic Location (Zv9):
Chromosome 9 (position 211702)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 272808
GRCz11 9 272441
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCCTCCACAACCTGCGCAAGCTGTTCGTTCAAGACCTCACGACTCGGGTT[A/T]AAAAAGTGAGTTCAGCACCTGAACATGGATCATGCGCTGGAGAGATCTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7168
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044227 None None 349 None 11
ENSDART00000110704 Essential Splice Site 929 1033 24 29
Genomic Location (Zv9):
Chromosome 9 (position 213503)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 271007
GRCz11 9 270640
KASP Assay ID:
554-5350.1 (used for ordering genotyping assays)
KASP Sequence:
GCCATGAGRCTGCGTTACCCACTGCGCCGSCCCAACGCCGCTCAGATCGG[T/C]ACRCTGAACACTGCATTCACATTCACACACACTCTCTCAGATCCTCTTTA
Associated Phenotype:
Not determined