Busch Lab

ZMP

foxp2

Ensembl ID:
ENSDARG00000005453
ZFIN ID:
ZDB-GENE-041203-2
Description:
forkhead box protein P2 [Source:RefSeq peptide;Acc:NP_001025253]
Human Orthologue:
FOXP2
Human Description:
forkhead box P2 [Source:HGNC Symbol;Acc:13875]
Mouse Orthologue:
Foxp2
Mouse Description:
forkhead box P2 Gene [Source:MGI Symbol;Acc:MGI:2148705]

Alleles

There are 8 alleles of this gene:

Allele Name Consequence Status Availability
sa121 Nonsense F2 line generated Not yet available
sa190 Nonsense Confirmed mutation in F2 line Not yet available
sa33376 Nonsense Mutation detected in F1 DNA Not yet available
sa40221 Nonsense Mutation detected in F1 DNA Not yet available
sa152 Nonsense Available for shipment Available now
sa13041 Essential Splice Site Available for shipment Available now
sa11787 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa121
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060861 Nonsense 67 697 2 16
ENSDART00000134820 Nonsense 67 697 7 21

The following transcripts of ENSDARG00000005453 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 4 (position 5854238)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 6456782
GRCz11 4 6465352
KASP Assay ID:
554-1486.1 (used for ordering genotyping assays)
KASP Sequence:
CTCTTCTCTTTTCTTTGCAGGCCCTACAAGCAGCAAGGCAATTACTCCTA[C/T]AGCAACCAGGCAGTGGCCTGAAATCTCCAAAGAACAACGACAAACAGCGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa190
Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060861 Nonsense 109 697 3 16
ENSDART00000134820 Nonsense 109 697 8 21

The following transcripts of ENSDARG00000005453 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 4 (position 5844731)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 6447275
GRCz11 4 6455845
KASP Assay ID:
554-0103.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAATGATGAGTCCACAGGTGATCACACCCCAACAGATGCAGCAGATCCTT[C/T]AACAGCAAGTCCTTTCCCCCCAGCAGCTCCAAGCCCTCTTACAACAACAA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa8153
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060861 Nonsense 125 697 3 16
ENSDART00000134820 Nonsense 125 697 8 21

The following transcripts of ENSDARG00000005453 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 4 (position 5844683)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 6447227
GRCz11 4 6455797
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTCAACAGCAAGTCCTTTCCCCCCAGCAGCTCCAAGCCCTCTTACAACAA[C/T]AACAGGCAGTCATGCTTCAGCAGGTGARCACACACAAAYACTCGCTGTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33376
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060861 Nonsense 142 697 4 16
ENSDART00000134820 Nonsense 142 697 9 21

The following transcripts of ENSDARG00000005453 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 4 (position 5843390)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 6445934
GRCz11 4 6454504
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGAATGTCCATGTCTTTCCACAGCAACACCTGCAGGAGTTTTATAAGAAA[C/T]AACAGGAACAACTTCATCTACAGCTTTTGCAGCAACAGCACCCAGGCAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40221
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060861 Nonsense 169 697 5 16
ENSDART00000134820 Nonsense 169 697 10 21

The following transcripts of ENSDARG00000005453 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 4 (position 5841020)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 6443564
GRCz11 4 6452134
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTCTCTCTCTTTCTCTCTATCTCTCACTATAGCAACAGCAGCAGCAGCAG[C/T]AGTTGGCGGCACAGCAGCTGGTCTTTCAGCAGCAGCTCTTGCAAATGCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa152
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060861 Nonsense 353 697 8 16
ENSDART00000134820 Nonsense 353 697 13 21

The following transcripts of ENSDARG00000005453 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 4 (position 5833989)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 6436533
GRCz11 4 6445103
KASP Assay ID:
554-0014.1 (used for ordering genotyping assays)
KASP Sequence:
TGGATGACAGGAGTACTGCGCAGTGCCGAGTACAGATGCAGGTGGTACAA[C/T]AGCTAGAGATACAGGTACAGTAGACGCACAATTATCATCCCAAACATACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13041
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060861 None 456 697 None 16
ENSDART00000134820 Essential Splice Site 456 697 None 21

The following transcripts of ENSDARG00000005453 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 4 (position 5825554)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 6428098
GRCz11 4 6436668
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GCCATGCGKAGACGCCACACCGACAAATACTCCATGGCCTTGTCCTCAGG[T/C]TCGAASATGTTTTTCTTTTTATTCAGAYGATGCTAAAATCAAACCATCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11787
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060861 None 506 697 12 16
ENSDART00000134820 Nonsense 506 697 17 21

The following transcripts of ENSDARG00000005453 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 4 (position 5824802)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 6427346
GRCz11 4 6435916
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CAGCTARCGCTCAACGAAATCTACAGCTGGTTCACGCGCACCTTCGCCTA[C/A]TTCCGACGYAACGCCGCCACCTGGAAGGTAATGTCCTTGCAAGGCTTGAA
Associated Phenotype:
Not determined