Busch Lab

ZMP

ckap5

Ensembl ID:
ENSDARG00000005446
ZFIN IDs:
ZDB-GENE-051120-174, ZDB-GENE-051120-174, ZDB-GENE-051120-174
Description:
Microtubule-associated protein 215 short isoform [Source:UniProtKB/TrEMBL;Acc:D3W653]
Human Orthologue:
CKAP5
Human Description:
cytoskeleton associated protein 5 [Source:HGNC Symbol;Acc:28959]
Mouse Orthologue:
Ckap5
Mouse Description:
cytoskeleton associated protein 5 Gene [Source:MGI Symbol;Acc:MGI:1923036]

Alleles

There are 8 alleles of this gene:

Allele Name Consequence Status Availability
sa11488 Essential Splice Site Available for shipment Available now
sa6795 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa24594 Essential Splice Site Available for shipment Available now
sa9797 Nonsense Available for shipment Available now
sa24595 Nonsense Available for shipment Available now
sa457 Essential Splice Site Confirmed mutation in F2 line Not yet available

Mutation Details

Allele Name:
sa11488
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045607 None None 134 None 19
ENSDART00000123666 None None 990 None 21
ENSDART00000127575 Essential Splice Site 326 2033 7 44
Genomic Location (Zv9):
Chromosome 25 (position 5003593)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 13683855
GRCz11 25 13780255
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CAAAATTAGAGAGTGGAGACTATGGGGACCTGGWCCGAGCACTAAAAAAG[G/A]TAGGAGTCTTAGTGAGATTTTGGTTAATAGGGTAATCTCTGTAAGACCAA
Long Flanking Sequence:
ACACTGAAGCATTTGCTTATACATCTAGCTGTTATTATGACTAAATCCGGTTTTAGGAAGCTATTAAATTGCGGCAGCTTATGTTTATATATCATTTAAAAAAACATTTTTAGAAATACATTTATTTTAATAGTCATTTTGGTTCAGTTTTAACTGTTTTGTTTCATTGATTGGATGCATTAATTTCTTCCTGTAGGAGACGATGAAGAAGTGGCTGAAGCTGTTCAGGTTGATGCTTACGAGCTCCTGGAAGCTGTTGAGATCCTTTCAAAGCTTCCCAAGGATTTCTATGAAAAAATTGTAAGTCAGAAATGAGTTCTGTTTACATGATCCTTGGATGCTGTTTGAACTACTTTATTTTGATGTTGTAACCTTCTTGACCACAGGAAGCAAAGAAATGGCAGGAGAGGAAGGAAGCGCTGGAAGCAGTGGAGGCTTTAACTAAAAACCCAAAATTAGAGAGTGGAGACTATGGGGACCTGGTCCGAGCACTAAAAAAG[G/A]TAGGAGTCTTAGTGAGATTTTGGTTAATAGGGTAATCTCTGTAAGACCAATAAGTAAAACGCTCTTTTGTTGTAGGTTATTGGGAAAGATGCCAATGTGATGCTAGTGTCCATGGCAGCCAAATGCTTGGCTGGATTGGCAACAGGACTGAGGAAGAAGTTTGGGACATATGCAGGTCTTGTAAGTGCTTTCATGGCTTAAATTGGCACAGACAATTTCACTTATTTTTTCCTAACTTATTTTGTTGCGTTTTTAATTAAAGTGCTGGTAATGTGTATTTTTAAAAAATATCTAATGTAGATGTTCTTCAGTGTAAACAGTCTGCAAAATTGTTAGTCAAACTGCATAAGAAATGTATATTGTGTCTTGAAAGTAAGAGTCAGCTCATAATCACGTTAAGTCATTACGTTATCAAATCTTTAACTGTTTACCGAGCTACGCCAACGCTATCAAAACAAATCTGCATAACCAGGCATGAACAGACCTTTTTTACAAGATGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6795
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045607 None None 134 None 19
ENSDART00000123666 None None 990 None 21
ENSDART00000127575 Essential Splice Site 640 2033 15 44
Genomic Location (Zv9):
Chromosome 25 (position 5008431)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 13679017
GRCz11 25 13775417
KASP Assay ID:
554-4048.1 (used for ordering genotyping assays)
KASP Sequence:
AGTCAAGATGCTGGCGAAGAAACCTGGGTGGAAAGAGACCAACTTCCAGG[T/C]AGTTCTCTTTAGTGTGATGCTGTTCATAGTTGTCTGATATTTGTTGTGGT
Long Flanking Sequence:
TCATGTTGCAGGCTGCAGGACCTCCCAAAAAGGGCAAACCTGCTGCGGCCCCGAGTGCAAAGTCCAAGAAAGCTCCAGAAACTAAGGAAATAATCGAGACCGAGTTATCTGTAGGTTTAAAATTTGACCTATTTAACCATTTTTATTCATCTTAAAAGAACGGTATAATGCAAAGTTGGTTATTGTGTGTTAATCAGCCTGAAGTGTGTGAGGAGAAAGCAGCCGCTGTTCTCCCAGCCTCCTGTATGCAGCTGCTGGACAGCGCCAACTGGAAGGAGAGACTTGCCAGCATGGAGGAGTTTCAAAAGGTCACTTGTGGATTTTTTTATTTTTCTCCATCTATTTGATAGAGATTTCAATTTGAGGGAACGTGCTCTAAACTTGTCTTGGTTTTCATTCTACTCAGGCCGTGGAACAGATGGACAAATCTGAAATGCCCTGCCAGGCTTTAGTCAAGATGCTGGCGAAGAAACCTGGGTGGAAAGAGACCAACTTCCAGG[T/C]AGTTCTCTTTAGTGTGATGCTGTTCATAGTTGTCTGATATTTGTTGTGGTGTTGATTTCCAATGTGCTTTCTTTGTTAGGTGATGCAAATGAAGCTCAGCATCGTGGGGCTAGTTGCACAAAAGGGCCAGTTCTCAAAAACGTCTGCACTGGTGGTTCTGGACGGCCTGGTTGATAAGATTGGAGATGTGAAGTGTGGAGGTAACGCTAAAGAGGCTCTCACTGCAATCGGAGAGGCCTGTTCTCTGCCATGGACTGCTGAGCAGGTTGGTGGTTTAATCTAGCAAGAAATTATTAATAGATTAATATAATTATATAATATATTTATATGTATATTTATTTATTTATTTATTTATTATAAATAAAGGTAGTTGTTTGTTTTCAGTTTTACAGTTACACGCTCCGACTAAAAATAATAATATATTTGACAAGTAATCACAAAATCAATAATTTATTATTAATACACATCTATTATAATTTTACTCTTAATTGGGCTTTAAT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa30194
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045607 None None 134 None 19
ENSDART00000123666 None None 990 None 21
ENSDART00000127575 Essential Splice Site 842 2033 20 44
Genomic Location (Zv9):
Chromosome 25 (position 5012837)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 13674611
GRCz11 25 13771011
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACGGTGGAGCTGGAGACATCATGGACATGCTGCCCAGAACTGACATCAGG[T/G]CAGTCAGAGACTGGCTTCAGAAATTCTTCTTTTTTAATAATGGATCCATC
Long Flanking Sequence:
CACTCTCGTTGGAGAAATTTGCTTTCACCATCCAAAATAAATAAAGTTATCCAACATGTGCGTCCGATAGCTCCGCCCCTTCCGCTACGTATGCAAACCTGCGGTCGTTGAGTGCGTGAAGTGTCCATCATTACACACTTCATTTTAGCAGCTGAATGAGTGCATCATCCGGGTAATTAAAGTGCACTTATGATTTTTAGAGTTTTCAGTGTGAACACACTACTTTCACTGTTTATACTACAAAATGGCGTAGAATAGTGCATAAGTATGCGATTTGGGACGCAGCTCATGACTTTGCTGCATCACCTTGGCTAATAAATTTTTTTAGTTATTTTACATTGTCATGCTATCTGTCATAGATGCAGGGTCAGTCTCCTCCGGCCCCCACTCGTGGAGCCAAAAAAGCAGGAGCAGAGGAGGATGGCGATGTGGCTGATGAAGACGAGGCAGACGGTGGAGCTGGAGACATCATGGACATGCTGCCCAGAACTGACATCAGG[T/G]CAGTCAGAGACTGGCTTCAGAAATTCTTCTTTTTTAATAATGGATCCATCCAGTGTTCATTTTAACAGCAAATTTTGATTTGGTTTTATTCTTAGTCTTTTGACTAAAATTCCATTTGAGTTTTTCATATTTTTGTCTTCTGAATCATTTTAGTTTTAGTCAAATACATTTCATAAGATTTTAGCCTACTTAATCTACTCTATTTAGTTGACTGAAATATATTTGGTTTAAGTGTAATATAATTAAATTTTGTATACATTTAATACAAATATTCTAACTTAAAAGTAAATAAAACTATTTAATAGATATGCATTGTTTATTTATAGCATAAGTAATACGTAAAATTGTGTCCGCGATCAATCCACATGTAGCCGTCTTGAAATGCAGGATTGTGCAAGTATTTAGCAAACTCTTTATTTCAACCTGGCAAACTACTAGTCTTTTTAACCAGTCTGTTTAACCATTCCAAGCCATTAAATCTTTGTAGGGGCTTAAAATAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24594
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045607 Essential Splice Site 60 134 2 19
ENSDART00000123666 None None 990 None 21
ENSDART00000127575 Essential Splice Site 1123 2033 26 44
Genomic Location (Zv9):
Chromosome 25 (position 5017851)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 13669597
GRCz11 25 13765997
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAAACCCGACACTAAGAAAGCTAAACCAGCAGGTCCTGCGGCTAAAAAGG[T/C]GTGGCACATTTCACTGTTTTCTGTTGTTGTAGGGAGTTGCTGCTAATAAA
Long Flanking Sequence:
ATTCTGTAATTGTGTTCCTGGGTCTCCACTTTTGCCATGACCTCTTTTGGCTTTAACATGCTTATCCCTCAGGTTTTTCCAAACTTTTTAACAAAAAACTTCCTTTTCCACTGCTGTTGCAATTTCTAGCCAAGAATTATAGGTTATCTGGTTATCCGTATGATCACGCATGGATGGATCATAAAGATGTCTGTACCTGTTTCAGACAAAAAAAAAAAAAACTCTTCAAAGTGATTCATATTAAGCTCAAATCAAACTGTTTGCTTGGGTCTCTAAAAATTTTGCGCGGTCGTCCAGCTGAAATCATGTCGTGCGCACCCAAAGCAAACCTTTTTTTTTTCTATTATTTTCAACAACTTGGAAAAAGTCTTGAATTACTTTAACTGTCATTTATTTTACAGCTCCAGCCAGGAATCATAGTCCCGTTGATGACTACAGTGAACCTGAACCCAAACCCGACACTAAGAAAGCTAAACCAGCAGGTCCTGCGGCTAAAAAGG[T/C]GTGGCACATTTCACTGTTTTCTGTTGTTGTAGGGAGTTGCTGCTAATAAAACAATCCAATCTGTGATCTAAATCATCCGGTGCCTAATACACAAGGGGCTGTCCATGAAAAGACAATGACAGTGTTCTTTCTCAGTTCAAAAATAAGCCTCTATTAAAAGTACATTTAAACGCTGGCCTAGTTTTCTGTGAAAGTCAAAAGACCATGGATTGGGTTCTGCATTTTTTAAGTGTTTTGAAATGTGCTGCGTCGTTTTCTGCACTAGAGCGAAAGCATGGAGCTCAAGGTGAAAGGAGAAAAAGATAATGCTAAGCAAAACAGGCTCTCAAGAGGGCCTCCTAGCAGTGAAAAGGTATATTGGAATCTCATATAGTGCACTACTGGAGCAGGTTTGGTGTGGAAGCACTGCATGTGGTGTTGTCATTAGATTCACAACGTTTCTGTCTTTGCAGTGATCTTTATTCAGTTGTAATGATTCAGTCCAATTTCAGCTTTTGAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9797
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045607 Nonsense 122 134 4 19
ENSDART00000123666 Nonsense 171 990 6 21
ENSDART00000127575 Nonsense 1214 2033 29 44
Genomic Location (Zv9):
Chromosome 25 (position 5020259)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 13667189
GRCz11 25 13763589
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGTGGAACTTCATYACTCCTCGTGACGAGTACGTAGAGCAGCTCAAAACT[C/T]AAATGTCAACATGTCTGGCCAAGTGGCTACAAGACGAGCTCTTCCACTTC
Long Flanking Sequence:
CAAATATTCACTTTAAACTTGATATATGCTAAGGTAACTTTATTGGAAATTTCTTAAATTCATTGTCGCACTGTGTTTTTGAACTAGTATATAATTTTACAAAGCAGAAATCGCAGAGCTCAGCAAACACTAAGCCAAAGAATCTAATATCAAAGAAGACTTCCCAACCTGAGCTAGTGATTCAGAGTACATAAAATGTTGTCCTGCCACTTTAGGTTGTTGCAGGAAAGAAACCTCCTGTTAAGGCTGGCGCAAAAGATGAGGAGGATAAGTCTGGTCCTATTTTCATCCTCGTTCCCAATGGCAAAGAGCAGAGAATCAAAGAAGAGAAGTCATTAAAGGTGAGCAGCGTCTCAGTGGTACTTGTGAATATTTGTCAACACTATTGAGTGGCATCTTTAGGCTCATCGTGTGTATGCGTTTGCTTACCAACTCTCCTCTAGATTCTGAAGTGGAACTTCATTACTCCTCGTGACGAGTACGTAGAGCAGCTCAAAACT[C/T]AAATGTCAACATGTCTGGCCAAGTGGCTACAAGACGAGCTCTTCCACTTCGACTTTCAGCATCACGTAAAGGCTATCGGAGCCATGATTGAGGTTTGTCATGTCAAAGCAGATGGCGAGTACGTAATTGCATCAAGCTGTACTACACTAATGTGTTTTATCTGTTATCCAGCACATGGAGGCCGAGTCTGAGGCTGTGATTGGCTGTCTGGACCTGGTGTTGAAGTGGTTTACTCTGCGCTTCTTTGACACCAACACTAGTGTGATCATGAAAACCCTGGAGTTCCTCAAGATGCTCTTCACCATGCTGAGCAGGAAAAACTACCAGCTCAATGACTACGAGGCCTCGTCTTTCATTCCTTACCTGATCCTTAAGGTAGAATTTATCTACCTGAACATTAACTATGAAGACAATTTGTTGAGAAACGGCCTGACGGGGTCCTTTTTTTTGCTTTCTTGTCTCTGAGCAGGTTGGAGAGTCTAAAGATGTTGTGCGCAAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24595
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045607 None None 134 5 19
ENSDART00000123666 Nonsense 252 990 7 21
ENSDART00000127575 Nonsense 1295 2033 30 44
Genomic Location (Zv9):
Chromosome 25 (position 5020583)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 13666865
GRCz11 25 13763265
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACCCTGGAGTTCCTCAAGATGCTCTTCACCATGCTGAGCAGGAAAAACTA[C/A]CAGCTCAATGACTACGAGGCCTCGTCTTTCATTCCTTACCTGATCCTTAA
Long Flanking Sequence:
AAGAGAAGTCATTAAAGGTGAGCAGCGTCTCAGTGGTACTTGTGAATATTTGTCAACACTATTGAGTGGCATCTTTAGGCTCATCGTGTGTATGCGTTTGCTTACCAACTCTCCTCTAGATTCTGAAGTGGAACTTCATTACTCCTCGTGACGAGTACGTAGAGCAGCTCAAAACTCAAATGTCAACATGTCTGGCCAAGTGGCTACAAGACGAGCTCTTCCACTTCGACTTTCAGCATCACGTAAAGGCTATCGGAGCCATGATTGAGGTTTGTCATGTCAAAGCAGATGGCGAGTACGTAATTGCATCAAGCTGTACTACACTAATGTGTTTTATCTGTTATCCAGCACATGGAGGCCGAGTCTGAGGCTGTGATTGGCTGTCTGGACCTGGTGTTGAAGTGGTTTACTCTGCGCTTCTTTGACACCAACACTAGTGTGATCATGAAAACCCTGGAGTTCCTCAAGATGCTCTTCACCATGCTGAGCAGGAAAAACTA[C/A]CAGCTCAATGACTACGAGGCCTCGTCTTTCATTCCTTACCTGATCCTTAAGGTAGAATTTATCTACCTGAACATTAACTATGAAGACAATTTGTTGAGAAACGGCCTGACGGGGTCCTTTTTTTTGCTTTCTTGTCTCTGAGCAGGTTGGAGAGTCTAAAGATGTTGTGCGCAAAGATGTCCGTGCTATTTTGGCGATGCTGTGTAAAGTCTACGCAGCGAGCAAAGTATTCCCTTACCTTATGGATGGGACCAAATCAAAGAACTCAAAGCAAAGATCTGGTAAGTGTGGTTTCCTCAAACCTTTAGATGCTTTCTACTGTGTAATGTACATTTTATTGATTTATTTTTTCACTCTTTCCAGAATGTCTCGAGGAGCTTGGCTGCCTGATTGAGAACTTCGGTATGAATGTATGCCAACCGACTCCGGCCAAGGCTCTGAAAGAAATCGCTGTCCATATTGGAGACCGTGACACTACAGTCCGCAATGCTGCCCTTAAT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3323
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045607 None None 134 7 19
ENSDART00000123666 Nonsense 316 990 9 21
ENSDART00000127575 Nonsense 1359 2033 32 44
Genomic Location (Zv9):
Chromosome 25 (position 5020951)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 13666497
GRCz11 25 13762897
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ACTGTGTANNNATGTACATTTTATTGATTTATTTTTTCACTCTTTCCAGAATG[T/A]CTCGAGGAGCTYGGCTGCCTGATTGAGAACTTCGGTATGAATGTATGCCA
Long Flanking Sequence:
GGCTGTGATTGGCTGTCTGGACCTGGTGTTGAAGTGGTTTACTCTGCGCTTCTTTGACACCAACACTAGTGTGATCATGAAAACCCTGGAGTTCCTCAAGATGCTCTTCACCATGCTGAGCAGGAAAAACTACCAGCTCAATGACTACGAGGCCTCGTCTTTCATTCCTTACCTGATCCTTAAGGTAGAATTTATCTACCTGAACATTAACTATGAAGACAATTTGTTGAGAAACGGCCTGACGGGGTCCTTTTTTTTGCTTTCTTGTCTCTGAGCAGGTTGGAGAGTCTAAAGATGTTGTGCGCAAAGATGTCCGTGCTATTTTGGCGATGCTGTGTAAAGTCTACGCAGCGAGCAAAGTATTCCCTTACCTTATGGATGGGACCAAATCAAAGAACTCAAAGCAAAGATCTGGTAAGTGTGGTTTCCTCAAACCTTTAGATGCTTTCTACTGTGTAATGTACATTTTATTGATTTATTTTTTCACTCTTTCCAGAATG[T/A]CTCGAGGAGCTTGGCTGCCTGATTGAGAACTTCGGTATGAATGTATGCCAACCGACTCCGGCCAAGGCTCTGAAAGAAATCGCTGTCCATATTGGAGACCGTGACACTACAGTCCGCAATGCTGCCCTTAATACTGTCGTAGCGGCCTATAATGCCTGTGGAGACCAAGTCTTCAAACTCATCGGCAATGTAAGATACTAGTTGCCAATCGAATTTGTTTCACGTAATGGTGAATATTAGTCAAATAATCACATTTTATTTAGGTGGTTGATTACTTTAAAAAGCAGGGTCTCAAATGTAAGTCCCACACAAAAAAGCTATTAATTAATTCATTTTGTAAAATGTTTATTAAAGGAACTGCACAAAGGAACAGAACCCAAAAATGTCAAATTGTCATTTATTGACCTTTGACATGTTCCAAACTAGTTTTGAGGAGTATTTTTCACGAAAGATCATTCGAAGATTGTTTCAAACTTTTAGCCATTGACTTAAATATTGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa457
Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045607 Essential Splice Site None 134 9 19
ENSDART00000123666 Essential Splice Site 435 990 11 21
ENSDART00000127575 Essential Splice Site 1478 2033 34 44
Genomic Location (Zv9):
Chromosome 25 (position 5023978)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 13663470
GRCz11 25 13759870
KASP Assay ID:
554-0385.1 (used for ordering genotyping assays)
KASP Sequence:
AATGCTGTTATATGAACATAATTAATATTTTTATGTGTCCATTTTCAACA[G/A]TCAAGCTCGGCAGCAGAACGCTCACTTGGAGCAGTCGGCTCCATCCATCC
Long Flanking Sequence:
CGCACTTACAGGATGTAAGTACTGCCGTACTGCTCACAAGGCACCTGACATCCTGGAGGGCTAGGGATCACAATGAAATATTAGAGATTATTAGATTGTACGGCTGATTGTGATGTCATATGAAATCATTCAAGATCATTTTTTACATAATTGGAGGTTTAAAAGAACAGTTTTGTTTGAAGTGGTAAGGTTGAAAAATGCCTTGGCTAGAAAAAAAAAATCAGTGTATCGTTGTTCATTTTAATGTATAAAAAAACAAGCAAGTTCAAGCTTTTTTCTGTTGAGTTATATTATATTAAATCTATCTACAATTAATCAATATCACCATTTTAAATATTACTTTCATATACTTGTTGTTGGAAGTGATTTATTTTAGTTCCCTTCTACTGATAATGAACAAGAATTCAGTCTTACTCATGTTCATGGCTGCTCTGTAAATAAGAGTATTGTAATGCTGTTATATGAACATAATTAATATTTTTATGTGTCCATTTTCAACA[G/A]TCAAGCTCGGCAGCAGAACGCTCACTTGGAGCAGTCGGCTCCATCCATCCCGAAAGAGTTTCAGCTGGATCTGGATGTCTTCGAGAACAACCACACGTGTGCCAGCGACATCCCTGACCTGGTGCAGCACAAACTGGATGAAGTTCTGGAGCCGGTCATGATTCCTGAGCGCAAGTATGAGTTCAGCACAACACAGCTAAATGGATTGTATGCTGAAATACTTCAGCATAGTCAATGCAATAGTGTATTGCTGCTGTTAAAGGAATTAAATATGTGTTTCTGCTGTTTTCAGAATTCATTCGGTCTCTCCTCATTTTGATGACATTCACAATAGCACTGCCTCCACTATCAACTTTGTCATCTCCCAGGTGGCTAGTGGAGACATTAACACCAGTATCCAGGCTTTGGCACAGGTGGGTTTAATTCCAACTCCCTCTTCATTGGATTTTAGTAATAAACAATTAACGTTTTAAGCAACAAGTGCTTTTTTTTATGTTTTT
Associated Phenotype:
This allele has been associated with this phenotype by genetic linkage analysis and may not be causal.
See FAQs for more info.
Control; 24 hpf
Control; 24 hpf
Mutant; 24 hpf
Mutant; 24 hpf
Stage Entity Quality Tag
Pharyngula:Prim-5
ZFS:0000029
brain
ZFA:0000008
necrotic
PATO:0000647
abnormal
PATO:0000460