Busch Lab

ZMP

wdfy1

Ensembl ID:
ENSDARG00000005425
ZFIN ID:
ZDB-GENE-041024-4
Description:
WD repeat and FYVE domain-containing protein 1 [Source:RefSeq peptide;Acc:NP_001007058]
Human Orthologue:
WDFY1
Human Description:
WD repeat and FYVE domain containing 1 [Source:HGNC Symbol;Acc:20451]
Mouse Orthologue:
Wdfy1
Mouse Description:
WD repeat and FYVE domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:1916618]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa22723 Nonsense Available for shipment Available now
sa32063 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa22723
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027019 Nonsense 60 410 2 12
Genomic Location (Zv9):
Chromosome 15 (position 42073283)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 43345341
GRCz11 15 43226319
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTATTTCAGGACGATTCGGGTTTGGCTGAAGCGAGACAGTGGACAGTACT[G/A]GCCCAGCATTTACCACACTGTGTCCTGTGAGTATCATAGCCTCTCAAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32063
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027019 Essential Splice Site 69 410 2 12
Genomic Location (Zv9):
Chromosome 15 (position 42073255)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 43345313
GRCz11 15 43226291
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAGCGAGACAGTGGACAGTACTGGCCCAGCATTTACCACACTGTGTCCTG[T/C]GAGTATCATAGCCTCTCAAAAAAAACTGTTATAAAAGATCAAAATTAGAG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3944
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027019 Nonsense 217 410 7 12
Genomic Location (Zv9):
Chromosome 15 (position 42033592)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 43336122
GRCz11 15 43217100
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GTAGTGTTGGAGCGTTRTACTGGGATCCGGTTCACAGGTGGCTGTTTTCC[G/T]GAGCGTCTGATCACAGTGTGATCATGTGGGATATCGGCGGCAGACAGGGA
Associated Phenotype:
Not determined