Busch Lab

ZMP

il1b

Ensembl ID:
ENSDARG00000005419
ZFIN ID:
ZDB-GENE-040702-2
Description:
interleukin 1, beta [Source:RefSeq peptide;Acc:NP_998009]
Human Orthologue:
IL1B
Human Description:
interleukin 1, beta [Source:HGNC Symbol;Acc:5992]
Mouse Orthologue:
Il1b
Mouse Description:
interleukin 1 beta Gene [Source:MGI Symbol;Acc:MGI:96543]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa16617 Essential Splice Site Available for shipment Available now
sa31807 Nonsense Available for shipment Available now
sa21819 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa16617
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015991 Essential Splice Site None 272 1 7
Genomic Location (Zv9):
Chromosome 10 (position 46400973)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 45110103
GRCz11 10 44956715
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTCAACACACACTTTCACATGAGAAAGCAGAGGAACTTAACCAGCTCWGG[T/A]ATGTGGAGTGCAGATTACATGCATTTTACTAYTAYTATTATTATCAGTTA
Long Flanking Sequence:
ATGTTGTTTTTGTTATATTATTTACATTATTATCCAGTCCTATTAGGTGCACATGAGCTCAAAACTTTGCATTTTGGGGAAATTTGAATAATTGATTATTATATTTAAAAAAAAAAGAGTAATGCTTTATTTAATTATTTATTTTTAGTTTTCTCTCATAGTGCACACCGTGTTGTTGATATTCTGCCTCCTCGTTTTCTCATATATTGAAAAATATTGTGCTTTAATGGTTACACAGGTCGCCCTGCCATTAATCAGAGCGCTCACTTAAGAAAGTGTTTGCACACCCTAAAGGGGTTTGCCTCAATAATAATAAAAAAACCTGTTTGACATGACGATATCCTGAGCCGTCAGACATCCGCTGTTGTAAACCACGTCTACTTCCTCATCAAGGAATTTCCCGCTTCAACAGGATCATATAAAACACGAGCACGCTTTCACAGCCAGTCATTCAACACACACTTTCACATGAGAAAGCAGAGGAACTTAACCAGCTCTGG[T/A]ATGTGGAGTGCAGATTACATGCATTTTACTATTATTATTATTATCAGTTATATTCATCATTATTATTATTTAGTCATTTCTGCTTCATTTTTATAGAAATGATGGCATGCGGGCAATATGAAGTCACCATAGCTCCAAAAAAGTGAGTATTAATGCCGTTTTATATATATATATAATTCATAATATTTGCATATTTGGTCTAAAAAGCTGATATTTTGCAGTTTGTGGGAGACAGACAGTGCTGTTTATTCAGATTCTGATGAGATGGACTGTTCAGATCCGCTTGCAATGGTGAGTTATTTTACGTTTTATAAATGCTTTCTGTTTATACAATGTTTTTTCGAATGTAAGCAATAATTATGAGTGTGTTTGTGAGCGTGGAGCACTTAATCAATGCTAATTTACTTTGGTAAAATTTTAGTAATATCTAAAAAATAAATTTAATTTCATTGTATTCCAAAAAAATCTTTTGAATATTAGGTAAAATCATGTTTCATGAA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa1545
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015991 Nonsense 15 272 3 7
Genomic Location (Zv9):
Chromosome 10 (position 46400749)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 45110327
GRCz11 10 44956939
KASP Assay ID:
554-1488.1 (used for ordering genotyping assays)
KASP Sequence:
TANNATTCATAATATTTGCATATTTGGTCTAAAAAGCTGATATTTTGCAGTT[T/A]GTGGGAGACAGACRGTGCTGTTTATTCAGATTCTGATGAGATGGACTGTT
Long Flanking Sequence:
TAATGGTTACACAGGTCGCCCTGCCATTAATCAGAGCGCTCACTTAAGAAAGTGTTTGCACACCCTAAAGGGGTTTGCCTCAATAATAATAAAAAAACCTGTTTGACATGACGATATCCTGAGCCGTCAGACATCCGCTGTTGTAAACCACGTCTACTTCCTCATCAAGGAATTTCCCGCTTCAACAGGATCATATAAAACACGAGCACGCTTTCACAGCCAGTCATTCAACACACACTTTCACATGAGAAAGCAGAGGAACTTAACCAGCTCTGGTATGTGGAGTGCAGATTACATGCATTTTACTATTATTATTATTATCAGTTATATTCATCATTATTATTATTTAGTCATTTCTGCTTCATTTTTATAGAAATGATGGCATGCGGGCAATATGAAGTCACCATAGCTCCAAAAAAGTGAGTATTAATGCCGTTTTATATATATATATAATTCATAATATTTGCATATTTGGTCTAAAAAGCTGATATTTTGCAGTT[T/A]GTGGGAGACAGACAGTGCTGTTTATTCAGATTCTGATGAGATGGACTGTTCAGATCCGCTTGCAATGGTGAGTTATTTTACGTTTTATAAATGCTTTCTGTTTATACAATGTTTTTTCGAATGTAAGCAATAATTATGAGTGTGTTTGTGAGCGTGGAGCACTTAATCAATGCTAATTTACTTTGGTAAAATTTTAGTAATATCTAAAAAATAAATTTAATTTCATTGTATTCCAAAAAAATCTTTTGAATATTAGGTAAAATCATGTTTCATGAACACATCTTGTCAATTTCCTTCTTTCAATTTATTAAAACATAATTTGTGATTAGCGATATGCATTGCTTATGACTTAACTTGCACAACTTTAGGTTTTTTTAATAGTTACTTTTATTTTTTTGTTTTTAATATTTACAATATTTATTTAGTTGAATATCAGCTAAATATTGTCCTTATAATACCATACATCAATGTAAAGTTTATTTATCTTTCAGATCATGTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31807
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015991 Nonsense 23 272 3 7
Genomic Location (Zv9):
Chromosome 10 (position 46400724)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 45110352
GRCz11 10 44956964
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCTAAAAAGCTGATATTTTGCAGTTTGTGGGAGACAGACAGTGCTGTTTA[T/A]TCAGATTCTGATGAGATGGACTGTTCAGATCCGCTTGCAATGGTGAGTTA
Long Flanking Sequence:
ATTAATCAGAGCGCTCACTTAAGAAAGTGTTTGCACACCCTAAAGGGGTTTGCCTCAATAATAATAAAAAAACCTGTTTGACATGACGATATCCTGAGCCGTCAGACATCCGCTGTTGTAAACCACGTCTACTTCCTCATCAAGGAATTTCCCGCTTCAACAGGATCATATAAAACACGAGCACGCTTTCACAGCCAGTCATTCAACACACACTTTCACATGAGAAAGCAGAGGAACTTAACCAGCTCTGGTATGTGGAGTGCAGATTACATGCATTTTACTATTATTATTATTATCAGTTATATTCATCATTATTATTATTTAGTCATTTCTGCTTCATTTTTATAGAAATGATGGCATGCGGGCAATATGAAGTCACCATAGCTCCAAAAAAGTGAGTATTAATGCCGTTTTATATATATATATAATTCATAATATTTGCATATTTGGTCTAAAAAGCTGATATTTTGCAGTTTGTGGGAGACAGACAGTGCTGTTTA[T/A]TCAGATTCTGATGAGATGGACTGTTCAGATCCGCTTGCAATGGTGAGTTATTTTACGTTTTATAAATGCTTTCTGTTTATACAATGTTTTTTCGAATGTAAGCAATAATTATGAGTGTGTTTGTGAGCGTGGAGCACTTAATCAATGCTAATTTACTTTGGTAAAATTTTAGTAATATCTAAAAAATAAATTTAATTTCATTGTATTCCAAAAAAATCTTTTGAATATTAGGTAAAATCATGTTTCATGAACACATCTTGTCAATTTCCTTCTTTCAATTTATTAAAACATAATTTGTGATTAGCGATATGCATTGCTTATGACTTAACTTGCACAACTTTAGGTTTTTTTAATAGTTACTTTTATTTTTTTGTTTTTAATATTTACAATATTTATTTAGTTGAATATCAGCTAAATATTGTCCTTATAATACCATACATCAATGTAAAGTTTATTTATCTTTCAGATCATGTATAAATATCAATTTCCAAAAATGTACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21819
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015991 Essential Splice Site 150 272 5 7
Genomic Location (Zv9):
Chromosome 10 (position 46397418)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 45113658
GRCz11 10 44960270
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCCACATTTGCAGGCCGTCACACTGAGAGCCGGAAGCAGCGACTTGAAAG[G/A]TAAGCATCAGCATTTACACACCTGTGGGTTTATTTTACTGTAGAATTTAA
Long Flanking Sequence:
TAAAAATAAAATACAAAATAATTCAAATCTGCATCTTAAAAAAATACAAAATTAAATTCAAAGTGAAATCAAGACTATTTATTCCCCCATTGGCTGATTATTTAGCTTGTTTTAAGGAAAAACTCACTTCCTTTAGACTTAAAACAAGACAATCTTATTCACTAGTCTAGAAAGTGCTTTTTGGTATAAGAATTGTCAGATATTTGGACTAGAAACAAGTAGGAAAAGTCTCACACAATTTAAAATGCAGTCATGATGACTTTTGTGGAGAGAAAAAATAAGAGTATAAAGCATTTTGAAATGAACGTATGATCACTAATGTGTGTTTTCCTCCACAGAGCGTGAAGTGAACGTGGTGGATTCAGTGCCGTCTTACAATAAAACCAAAAACGTCTTGCAATGCACGATTTGCGATCAGTATAAGAAGTCTCTGGTGCTCAGTGGCGGATCTCCACATTTGCAGGCCGTCACACTGAGAGCCGGAAGCAGCGACTTGAAAG[G/A]TAAGCATCAGCATTTACACACCTGTGGGTTTATTTTACTGTAGAATTTAATTCAATTCAATATTTAAAACAAAAAGCATGATGTACATCACACTAGAGGCGTGTGGTAGAGTGTGACCAACACATGACTCTCCTTCAGAAATCTCAGCTTTTCTCCTGAATTTCCCCTGTTTTCACTTCCTCCAGTGCGCTTCAGCATGTCCACGTATGCGTCGCCCAGTGCTCCGGCTACTTCTGCTCAGCCTGTGTGTTTGGGAATCTCCAAAAGTAACCTGTACCTGGCCTGCAGCCCCGCCGAAGGCTCCGCTCCACATCTCGTACTCAAGGTTTGTGCTCCATGATTATTATTATTATTATTATTATTATTAATATTATTATTAGTATTAGTATTATTCTATTAAAGTGCTGTTTTTAACAAAGCAAGAACATTTTTCACTCTATTTCCTATTTATCTTTTCATCTGGAGAAAGTCTTAGATTTTCTGGAGCATAAATAAAAGAA
Associated Phenotype:
Not determined