Busch Lab

ZMP

gprc6a

Ensembl ID:
ENSDARG00000005371
ZFIN ID:
ZDB-GENE-041217-22
Description:
G-protein coupled receptor family C group 6 member A [Source:UniProtKB/Swiss-Prot;Acc:Q5U9X3]
Human Orthologue:
GPRC6A
Human Description:
G protein-coupled receptor, family C, group 6, member A [Source:HGNC Symbol;Acc:18510]
Mouse Orthologue:
Gprc6a
Mouse Description:
G protein-coupled receptor, family C, group 6, member A Gene [Source:MGI Symbol;Acc:MGI:2429498]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa14430 Nonsense Available for shipment Available now
sa36190 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14430
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008880 Nonsense 386 867 3 6
Genomic Location (Zv9):
Chromosome 16 (position 34470762)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 32202262
GRCz11 16 32156292
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GCAATGCTTCCAATACCGTGCTGGAGCTGATGAWAAGCACCAATTTRGAC[A/T]AGATTTTCAGCATTRAGATGGCCGTYACTGCTGTTGCTAATGCTGTGRCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36190
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008880 Nonsense 543 867 6 6
Genomic Location (Zv9):
Chromosome 16 (position 34472462)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 32203962
GRCz11 16 32157992
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCAATTTCAGATGCTGATGAATGTTCCCCATGTGACAGTGAGAGCATGTG[G/A]TCATTGGCCAACAGCACTGAATGTCATCCCAAGGTTTTTGAATACTTTGA
Associated Phenotype:
Not determined